Incidental Mutation 'R6464:Vmn1r74'
ID517734
Institutional Source Beutler Lab
Gene Symbol Vmn1r74
Ensembl Gene ENSMUSG00000047655
Gene Namevomeronasal 1 receptor 74
SynonymsV1rg5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R6464 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location11833980-11853276 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 11847204 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 144 (I144L)
Ref Sequence ENSEMBL: ENSMUSP00000154746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050416] [ENSMUST00000228471]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050416
AA Change: I144L

PolyPhen 2 Score 0.868 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000055148
Gene: ENSMUSG00000047655
AA Change: I144L

DomainStartEndE-ValueType
Pfam:7tm_1 22 290 1.3e-7 PFAM
Pfam:V1R 34 296 1.2e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210930
Predicted Effect possibly damaging
Transcript: ENSMUST00000228471
AA Change: I144L

PolyPhen 2 Score 0.868 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T A 16: 14,447,490 S769T probably damaging Het
Apoe G A 7: 19,697,536 T52M probably damaging Het
Arhgef10l A C 4: 140,586,815 M230R probably benign Het
Cdkl4 A T 17: 80,525,352 I321N probably benign Het
Ceacam5 T C 7: 17,747,466 probably null Het
Cfap70 T C 14: 20,401,039 probably null Het
Clasp2 A G 9: 113,773,717 Y195C probably damaging Het
Clip2 T C 5: 134,491,925 I999V probably benign Het
Cntnap5a A G 1: 116,184,408 D476G probably benign Het
Col6a6 C T 9: 105,788,953 M1I probably null Het
Cyp27a1 T C 1: 74,735,888 V292A possibly damaging Het
Cyp2c29 A G 19: 39,329,225 Y385C probably damaging Het
Dsg3 A C 18: 20,533,526 R597S probably benign Het
Fam131c T C 4: 141,382,342 I95T probably damaging Het
Fam13b A T 18: 34,473,631 C302* probably null Het
Fkbp15 T C 4: 62,308,078 K745E possibly damaging Het
Flg T A 3: 93,281,381 probably benign Het
Gm11559 T C 11: 99,864,716 C64R unknown Het
Gm14025 T C 2: 129,039,545 T154A possibly damaging Het
Gm35339 A G 15: 76,362,777 T1413A probably benign Het
Helt T C 8: 46,292,534 D104G probably damaging Het
Helz2 T C 2: 181,235,069 T1211A probably benign Het
Ifna9 T C 4: 88,592,250 R46G possibly damaging Het
Kif20b G A 19: 34,934,441 V235I probably benign Het
Kif7 A G 7: 79,714,094 V22A possibly damaging Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Lipf A T 19: 33,973,544 Y305F probably benign Het
Lpar1 A G 4: 58,486,875 L132P possibly damaging Het
Magi1 A T 6: 93,699,789 V834E probably damaging Het
Meltf T C 16: 31,890,776 Y432H probably benign Het
Mroh2a G C 1: 88,257,802 E1510D probably damaging Het
Myo1f T C 17: 33,576,647 L59P probably damaging Het
Naa25 G A 5: 121,417,961 D271N probably damaging Het
Olfr1038-ps A T 2: 86,122,408 I162F possibly damaging Het
Olfr1117-ps1 A T 2: 87,309,607 I273F probably damaging Het
Otoa A G 7: 121,102,605 Q169R probably damaging Het
Pde4dip C T 3: 97,710,344 D1723N probably damaging Het
Ptdss2 T C 7: 141,152,211 V175A probably damaging Het
Rdh8 G T 9: 20,823,400 R121L probably damaging Het
Rpl23 T C 11: 97,778,285 probably null Het
Scn5a T C 9: 119,534,580 D498G probably damaging Het
Slc39a14 G C 14: 70,306,728 L470V probably damaging Het
Smok2a C T 17: 13,226,430 A298V probably damaging Het
Tesk2 A C 4: 116,802,849 D388A probably damaging Het
Tnik G A 3: 28,611,970 probably null Het
Ube3a T A 7: 59,276,183 Y236* probably null Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Vmn2r1 G A 3: 64,101,345 D482N probably benign Het
Vwf T C 6: 125,639,400 probably null Het
Zfp703 C G 8: 26,979,327 P340A probably damaging Het
Znfx1 T C 2: 167,046,922 S789G probably benign Het
Other mutations in Vmn1r74
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01608:Vmn1r74 APN 7 11847633 missense probably damaging 0.98
IGL01673:Vmn1r74 APN 7 11847390 missense possibly damaging 0.94
IGL03023:Vmn1r74 APN 7 11847330 missense possibly damaging 0.46
IGL03409:Vmn1r74 APN 7 11847313 missense probably damaging 0.99
R0393:Vmn1r74 UTSW 7 11847315 missense possibly damaging 0.79
R1488:Vmn1r74 UTSW 7 11847583 missense probably benign 0.02
R1707:Vmn1r74 UTSW 7 11847577 missense probably damaging 0.98
R1998:Vmn1r74 UTSW 7 11847375 missense probably damaging 1.00
R1999:Vmn1r74 UTSW 7 11847375 missense probably damaging 1.00
R2139:Vmn1r74 UTSW 7 11847316 missense probably damaging 1.00
R4027:Vmn1r74 UTSW 7 11846971 missense probably damaging 0.98
R4576:Vmn1r74 UTSW 7 11846769 unclassified probably null
R4619:Vmn1r74 UTSW 7 11847471 missense possibly damaging 0.61
R4619:Vmn1r74 UTSW 7 11847476 missense probably damaging 1.00
R5371:Vmn1r74 UTSW 7 11847057 missense probably damaging 1.00
R5606:Vmn1r74 UTSW 7 11846895 missense probably benign 0.01
R6901:Vmn1r74 UTSW 7 11847441 missense probably benign 0.00
R6920:Vmn1r74 UTSW 7 11847648 missense probably benign 0.01
R7223:Vmn1r74 UTSW 7 11846967 nonsense probably null
R7231:Vmn1r74 UTSW 7 11846961 missense probably benign 0.34
R7418:Vmn1r74 UTSW 7 11847154 missense possibly damaging 0.88
R8135:Vmn1r74 UTSW 7 11847603 missense probably benign 0.36
RF049:Vmn1r74 UTSW 7 11847140 frame shift probably null
RF063:Vmn1r74 UTSW 7 11847140 frame shift probably null
Z1176:Vmn1r74 UTSW 7 11847009 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCACAGACACTGTCAAATTATGG -3'
(R):5'- GAATAGGCCATGAGACCCAG -3'

Sequencing Primer
(F):5'- TCCTAGATGACTTTGGATGTAAATTG -3'
(R):5'- GGCCATGAGACCCAGACACAG -3'
Posted On2018-05-21