Incidental Mutation 'R6464:Zfp703'
ID517741
Institutional Source Beutler Lab
Gene Symbol Zfp703
Ensembl Gene ENSMUSG00000085795
Gene Namezinc finger protein 703
SynonymsZeppo1, End2, 1110032O19Rik, Csmn1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.400) question?
Stock #R6464 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location26977325-26981461 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 26979327 bp
ZygosityHeterozygous
Amino Acid Change Proline to Alanine at position 340 (P340A)
Ref Sequence ENSEMBL: ENSMUSP00000128757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127097] [ENSMUST00000154256] [ENSMUST00000209411] [ENSMUST00000209610]
Predicted Effect probably benign
Transcript: ENSMUST00000127097
SMART Domains Protein: ENSMUSP00000132801
Gene: ENSMUSG00000085795

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 32 47 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000154256
AA Change: P340A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000128757
Gene: ENSMUSG00000085795
AA Change: P340A

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 32 47 N/A INTRINSIC
low complexity region 133 145 N/A INTRINSIC
low complexity region 164 191 N/A INTRINSIC
low complexity region 212 231 N/A INTRINSIC
low complexity region 261 275 N/A INTRINSIC
Pfam:nlz1 315 369 3.6e-24 PFAM
low complexity region 426 442 N/A INTRINSIC
ZnF_C2H2 460 488 1.16e1 SMART
low complexity region 497 541 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209411
Predicted Effect probably benign
Transcript: ENSMUST00000209610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210723
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T A 16: 14,447,490 S769T probably damaging Het
Apoe G A 7: 19,697,536 T52M probably damaging Het
Arhgef10l A C 4: 140,586,815 M230R probably benign Het
Cdkl4 A T 17: 80,525,352 I321N probably benign Het
Ceacam5 T C 7: 17,747,466 probably null Het
Cfap70 T C 14: 20,401,039 probably null Het
Clasp2 A G 9: 113,773,717 Y195C probably damaging Het
Clip2 T C 5: 134,491,925 I999V probably benign Het
Cntnap5a A G 1: 116,184,408 D476G probably benign Het
Col6a6 C T 9: 105,788,953 M1I probably null Het
Cyp27a1 T C 1: 74,735,888 V292A possibly damaging Het
Cyp2c29 A G 19: 39,329,225 Y385C probably damaging Het
Dsg3 A C 18: 20,533,526 R597S probably benign Het
Fam131c T C 4: 141,382,342 I95T probably damaging Het
Fam13b A T 18: 34,473,631 C302* probably null Het
Fkbp15 T C 4: 62,308,078 K745E possibly damaging Het
Flg T A 3: 93,281,381 probably benign Het
Gm11559 T C 11: 99,864,716 C64R unknown Het
Gm14025 T C 2: 129,039,545 T154A possibly damaging Het
Gm35339 A G 15: 76,362,777 T1413A probably benign Het
Helt T C 8: 46,292,534 D104G probably damaging Het
Helz2 T C 2: 181,235,069 T1211A probably benign Het
Ifna9 T C 4: 88,592,250 R46G possibly damaging Het
Kif20b G A 19: 34,934,441 V235I probably benign Het
Kif7 A G 7: 79,714,094 V22A possibly damaging Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Lipf A T 19: 33,973,544 Y305F probably benign Het
Lpar1 A G 4: 58,486,875 L132P possibly damaging Het
Magi1 A T 6: 93,699,789 V834E probably damaging Het
Meltf T C 16: 31,890,776 Y432H probably benign Het
Mroh2a G C 1: 88,257,802 E1510D probably damaging Het
Myo1f T C 17: 33,576,647 L59P probably damaging Het
Naa25 G A 5: 121,417,961 D271N probably damaging Het
Olfr1038-ps A T 2: 86,122,408 I162F possibly damaging Het
Olfr1117-ps1 A T 2: 87,309,607 I273F probably damaging Het
Otoa A G 7: 121,102,605 Q169R probably damaging Het
Pde4dip C T 3: 97,710,344 D1723N probably damaging Het
Ptdss2 T C 7: 141,152,211 V175A probably damaging Het
Rdh8 G T 9: 20,823,400 R121L probably damaging Het
Rpl23 T C 11: 97,778,285 probably null Het
Scn5a T C 9: 119,534,580 D498G probably damaging Het
Slc39a14 G C 14: 70,306,728 L470V probably damaging Het
Smok2a C T 17: 13,226,430 A298V probably damaging Het
Tesk2 A C 4: 116,802,849 D388A probably damaging Het
Tnik G A 3: 28,611,970 probably null Het
Ube3a T A 7: 59,276,183 Y236* probably null Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Vmn1r74 A T 7: 11,847,204 I144L possibly damaging Het
Vmn2r1 G A 3: 64,101,345 D482N probably benign Het
Vwf T C 6: 125,639,400 probably null Het
Znfx1 T C 2: 167,046,922 S789G probably benign Het
Other mutations in Zfp703
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02441:Zfp703 APN 8 26980008 missense probably damaging 0.98
R1524:Zfp703 UTSW 8 26979373 missense probably damaging 1.00
R2082:Zfp703 UTSW 8 26978988 missense probably benign 0.01
R4049:Zfp703 UTSW 8 26979085 missense possibly damaging 0.70
R4570:Zfp703 UTSW 8 26978953 missense probably benign 0.10
R4884:Zfp703 UTSW 8 26978701 missense probably benign 0.03
R4929:Zfp703 UTSW 8 26978851 missense possibly damaging 0.66
R4938:Zfp703 UTSW 8 26979773 missense probably damaging 1.00
R4943:Zfp703 UTSW 8 26979591 missense probably benign 0.35
R5117:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5118:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5297:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5465:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5466:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5467:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5492:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5493:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5494:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5757:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5758:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5802:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5828:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5850:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5854:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5856:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5959:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R6867:Zfp703 UTSW 8 26978640 missense probably damaging 0.97
R7067:Zfp703 UTSW 8 26979016 missense probably damaging 0.96
R7812:Zfp703 UTSW 8 26979878 missense probably damaging 1.00
R7880:Zfp703 UTSW 8 26978690 missense unknown
R8167:Zfp703 UTSW 8 26979754 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCAGACTGCAAGAACGGC -3'
(R):5'- AAGTGGAACAGCTTGAGCCG -3'

Sequencing Primer
(F):5'- CCGGCGAACTGGACAAG -3'
(R):5'- ACAGCTTGAGCCGCCGAG -3'
Posted On2018-05-21