Incidental Mutation 'R6465:Olfr1024'
ID517762
Institutional Source Beutler Lab
Gene Symbol Olfr1024
Ensembl Gene ENSMUSG00000075206
Gene Nameolfactory receptor 1024
SynonymsGA_x6K02T2Q125-47384320-47383337, MOR197-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R6465 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location85904069-85905052 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85904539 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 172 (S172T)
Ref Sequence ENSEMBL: ENSMUSP00000097496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099912]
Predicted Effect probably benign
Transcript: ENSMUST00000099912
AA Change: S172T

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000097496
Gene: ENSMUSG00000075206
AA Change: S172T

DomainStartEndE-ValueType
Pfam:7tm_4 36 313 7.6e-52 PFAM
Pfam:7tm_1 46 295 4.1e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215677
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230113P08Rik A T 9: 35,908,625 N25Y possibly damaging Het
A2ml1 G A 6: 128,541,078 T1415I probably damaging Het
Acvr2b T A 9: 119,433,303 W461R probably damaging Het
Adam23 G T 1: 63,566,668 C637F probably damaging Het
Apol8 T G 15: 77,749,948 T143P probably benign Het
Asna1 A T 8: 85,018,565 M291K probably benign Het
Bfsp1 A C 2: 143,858,055 probably null Het
Cytl1 T C 5: 37,737,670 V99A probably benign Het
Dock2 A T 11: 34,503,413 V793E probably damaging Het
Fxyd5 G T 7: 31,037,880 T81K probably damaging Het
Gcm1 A G 9: 78,064,869 Y364C probably damaging Het
Gm37596 A G 3: 93,692,996 I22T probably damaging Het
Gm9992 G T 17: 7,374,443 T202K probably damaging Het
Haghl T C 17: 25,783,819 N190S possibly damaging Het
Inpp5j C A 11: 3,502,293 R319L possibly damaging Het
Ints10 A G 8: 68,807,536 N304S probably benign Het
Isoc1 T A 18: 58,671,256 C119S probably damaging Het
Klhl18 A G 9: 110,428,920 M414T probably benign Het
Krtap2-4 A G 11: 99,614,759 probably benign Het
Krtap3-1 G A 11: 99,566,451 P45S possibly damaging Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Myo7a A G 7: 98,062,680 V1754A possibly damaging Het
Nedd4l T A 18: 65,155,264 D119E probably benign Het
Nsun7 T C 5: 66,295,586 V548A probably benign Het
Olfr711 A T 7: 106,972,212 V44E possibly damaging Het
Parvg A G 15: 84,328,940 D127G probably damaging Het
Piezo2 T A 18: 63,041,663 M2007L possibly damaging Het
Pou2f3 A C 9: 43,139,867 F175V probably damaging Het
Ptprn2 T C 12: 117,269,589 I958T probably damaging Het
Pwwp2b T C 7: 139,256,035 V464A probably benign Het
Pzp A G 6: 128,491,619 Y982H probably damaging Het
Rad17 T A 13: 100,637,080 N202I probably benign Het
Rtel1 T A 2: 181,335,940 D271E possibly damaging Het
Sos2 T C 12: 69,596,775 S943G probably benign Het
Tm9sf2 A G 14: 122,141,207 H241R probably benign Het
Ttc8 A G 12: 98,964,570 E291G probably damaging Het
Wfikkn1 A G 17: 25,878,718 C211R probably damaging Het
Ylpm1 T A 12: 85,049,802 D1219E probably damaging Het
Zc3hav1 T C 6: 38,331,849 Y586C possibly damaging Het
Zcchc4 T A 5: 52,819,276 F471I probably benign Het
Zfp719 C A 7: 43,590,684 Y565* probably null Het
Other mutations in Olfr1024
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01632:Olfr1024 APN 2 85904370 missense probably benign
IGL02108:Olfr1024 APN 2 85904150 missense possibly damaging 0.67
IGL02738:Olfr1024 APN 2 85904949 missense probably benign 0.06
IGL03343:Olfr1024 APN 2 85904941 missense probably benign
IGL02802:Olfr1024 UTSW 2 85904389 missense probably damaging 1.00
R0265:Olfr1024 UTSW 2 85904247 missense probably benign 0.01
R0271:Olfr1024 UTSW 2 85904289 missense possibly damaging 0.68
R0432:Olfr1024 UTSW 2 85904157 missense probably damaging 1.00
R0501:Olfr1024 UTSW 2 85905004 missense probably damaging 1.00
R0504:Olfr1024 UTSW 2 85904686 missense possibly damaging 0.95
R1513:Olfr1024 UTSW 2 85904671 missense probably damaging 1.00
R2224:Olfr1024 UTSW 2 85904755 missense probably benign 0.11
R2516:Olfr1024 UTSW 2 85904556 missense probably benign 0.01
R3845:Olfr1024 UTSW 2 85904737 missense probably damaging 0.99
R4871:Olfr1024 UTSW 2 85904371 missense probably benign
R4889:Olfr1024 UTSW 2 85904748 missense possibly damaging 0.48
R4890:Olfr1024 UTSW 2 85904748 missense possibly damaging 0.48
R5543:Olfr1024 UTSW 2 85904328 missense probably damaging 1.00
R5865:Olfr1024 UTSW 2 85904521 missense probably benign 0.00
R6254:Olfr1024 UTSW 2 85904505 missense probably damaging 1.00
R6331:Olfr1024 UTSW 2 85904216 missense probably benign 0.32
R7183:Olfr1024 UTSW 2 85904142 missense probably benign 0.00
R7427:Olfr1024 UTSW 2 85904131 nonsense probably null
R7428:Olfr1024 UTSW 2 85904131 nonsense probably null
R7552:Olfr1024 UTSW 2 85904103 missense probably benign 0.01
R7654:Olfr1024 UTSW 2 85904319 missense possibly damaging 0.95
R7674:Olfr1024 UTSW 2 85904536 missense probably damaging 1.00
R7980:Olfr1024 UTSW 2 85904598 missense probably benign 0.22
R8209:Olfr1024 UTSW 2 85904203 missense probably benign 0.14
R8226:Olfr1024 UTSW 2 85904203 missense probably benign 0.14
Z1177:Olfr1024 UTSW 2 85905045 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAGCCACAGGTAGATAAAGCC -3'
(R):5'- CTGAATATTACATGCTGGGTGC -3'

Sequencing Primer
(F):5'- CAGGTAGATAAAGCCTTTCGTTGCC -3'
(R):5'- GTGCCATGGCCTATGACAG -3'
Posted On2018-05-21