Mutagenetix > Incidental Mutations

Incidental Mutation 'R6465:Bfsp1'

517764

Institutional Source

Beutler Lab

Gene Symbol

Bfsp1

Ensembl Gene

ENSMUSG00000027420

Gene Name

beaded filament structural protein 1, in lens-CP94

Synonyms

filensin

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.130) question?

Stock #

R6465 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

143826528-143863173 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to C at 143858055 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000096899 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028907] [ENSMUST00000099296]

Predicted Effect

probably null
Transcript: ENSMUST00000028907

SMART Domains

Protein: ENSMUSP00000028907
Gene: ENSMUSG00000027420

Domain	Start	End	E-Value	Type
Pfam:Filament	34	205	2.5e-13	PFAM
low complexity region	400	411	N/A	INTRINSIC
low complexity region	544	561	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000099296

SMART Domains

Protein: ENSMUSP00000096899
Gene: ENSMUSG00000027420

Domain	Start	End	E-Value	Type
Filament	32	317	1.05e-6	SMART
low complexity region	406	417	N/A	INTRINSIC
low complexity region	550	567	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000120038

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.8%
20x: 93.1%

Validation Efficiency

95% (40/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lens-specific intermediate filament-like protein named filensin. The encoded protein is expressed in lens fiber cells after differentiation has begun. This protein functions as a component of the beaded filament which is a cytoskeletal structure found in lens fiber cells. Mutations in this gene are the cause of autosomal recessive cortical juvenile-onset cataract. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mutations in this gene produce lens abnormalities progressing to cataracts. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230113P08Rik	A	T	9: 35,908,625	N25Y	possibly damaging	Het
A2ml1	G	A	6: 128,541,078	T1415I	probably damaging	Het
Acvr2b	T	A	9: 119,433,303	W461R	probably damaging	Het
Adam23	G	T	1: 63,566,668	C637F	probably damaging	Het
Apol8	T	G	15: 77,749,948	T143P	probably benign	Het
Asna1	A	T	8: 85,018,565	M291K	probably benign	Het
Cytl1	T	C	5: 37,737,670	V99A	probably benign	Het
Dock2	A	T	11: 34,503,413	V793E	probably damaging	Het
Fxyd5	G	T	7: 31,037,880	T81K	probably damaging	Het
Gcm1	A	G	9: 78,064,869	Y364C	probably damaging	Het
Gm37596	A	G	3: 93,692,996	I22T	probably damaging	Het
Gm9992	G	T	17: 7,374,443	T202K	probably damaging	Het
Haghl	T	C	17: 25,783,819	N190S	possibly damaging	Het
Inpp5j	C	A	11: 3,502,293	R319L	possibly damaging	Het
Ints10	A	G	8: 68,807,536	N304S	probably benign	Het
Isoc1	T	A	18: 58,671,256	C119S	probably damaging	Het
Klhl18	A	G	9: 110,428,920	M414T	probably benign	Het
Krtap2-4	A	G	11: 99,614,759		probably benign	Het
Krtap3-1	G	A	11: 99,566,451	P45S	possibly damaging	Het
Mroh2a	GCCC	GC	1: 88,232,257		probably null	Het
Myo7a	A	G	7: 98,062,680	V1754A	possibly damaging	Het
Nedd4l	T	A	18: 65,155,264	D119E	probably benign	Het
Nsun7	T	C	5: 66,295,586	V548A	probably benign	Het
Olfr1024	A	T	2: 85,904,539	S172T	probably benign	Het
Olfr711	A	T	7: 106,972,212	V44E	possibly damaging	Het
Parvg	A	G	15: 84,328,940	D127G	probably damaging	Het
Piezo2	T	A	18: 63,041,663	M2007L	possibly damaging	Het
Pou2f3	A	C	9: 43,139,867	F175V	probably damaging	Het
Ptprn2	T	C	12: 117,269,589	I958T	probably damaging	Het
Pwwp2b	T	C	7: 139,256,035	V464A	probably benign	Het
Pzp	A	G	6: 128,491,619	Y982H	probably damaging	Het
Rad17	T	A	13: 100,637,080	N202I	probably benign	Het
Rtel1	T	A	2: 181,335,940	D271E	possibly damaging	Het
Sos2	T	C	12: 69,596,775	S943G	probably benign	Het
Tm9sf2	A	G	14: 122,141,207	H241R	probably benign	Het
Ttc8	A	G	12: 98,964,570	E291G	probably damaging	Het
Wfikkn1	A	G	17: 25,878,718	C211R	probably damaging	Het
Ylpm1	T	A	12: 85,049,802	D1219E	probably damaging	Het
Zc3hav1	T	C	6: 38,331,849	Y586C	possibly damaging	Het
Zcchc4	T	A	5: 52,819,276	F471I	probably benign	Het
Zfp719	C	A	7: 43,590,684	Y565*	probably null	Het

Other mutations in Bfsp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Bfsp1	APN	2	143831892	missense	probably damaging	1.00
IGL01457:Bfsp1	APN	2	143827644	splice site	probably benign
IGL02329:Bfsp1	APN	2	143862646	missense	probably benign
IGL02354:Bfsp1	APN	2	143831987	missense	probably damaging	1.00
IGL02361:Bfsp1	APN	2	143831987	missense	probably damaging	1.00
IGL02365:Bfsp1	APN	2	143826736	missense	probably damaging	1.00
IGL02407:Bfsp1	APN	2	143826933	missense	probably benign	0.00
IGL03118:Bfsp1	APN	2	143827333	missense	possibly damaging	0.94
I0000:Bfsp1	UTSW	2	143845968	missense	probably damaging	1.00
R0112:Bfsp1	UTSW	2	143827643	splice site	probably null
R0657:Bfsp1	UTSW	2	143827650	splice site	probably benign
R1642:Bfsp1	UTSW	2	143841763	missense	probably damaging	1.00
R1816:Bfsp1	UTSW	2	143841679	missense	probably benign	0.23
R2061:Bfsp1	UTSW	2	143862678	missense	probably benign	0.08
R2248:Bfsp1	UTSW	2	143827652	splice site	probably null
R3024:Bfsp1	UTSW	2	143845959	missense	probably benign	0.19
R4029:Bfsp1	UTSW	2	143831829	splice site	probably benign
R4914:Bfsp1	UTSW	2	143827471	missense	probably benign	0.21
R4915:Bfsp1	UTSW	2	143827471	missense	probably benign	0.21
R4917:Bfsp1	UTSW	2	143827471	missense	probably benign	0.21
R4918:Bfsp1	UTSW	2	143827471	missense	probably benign	0.21
R5018:Bfsp1	UTSW	2	143862882	missense	possibly damaging	0.81
R5202:Bfsp1	UTSW	2	143826971	missense	probably benign
R5267:Bfsp1	UTSW	2	143827051	missense	probably benign	0.03
R5304:Bfsp1	UTSW	2	143827291	missense	probably benign	0.34
R5825:Bfsp1	UTSW	2	143827459	missense	probably benign	0.01
R6888:Bfsp1	UTSW	2	143826719	missense	probably benign	0.31
R7036:Bfsp1	UTSW	2	143826923	missense	possibly damaging	0.65
R7075:Bfsp1	UTSW	2	143848965	missense	probably damaging	1.00
R7362:Bfsp1	UTSW	2	143826875	missense	probably benign	0.19
R7538:Bfsp1	UTSW	2	143831835	critical splice donor site	probably null
R7839:Bfsp1	UTSW	2	143831850	missense	possibly damaging	0.79
R7922:Bfsp1	UTSW	2	143831850	missense	possibly damaging	0.79
X0022:Bfsp1	UTSW	2	143858117	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGTCAACATACCTAGCATACC -3'
(R):5'- ATTATTGGGAAGCAGTGGGC -3'

Sequencing Primer
(F):5'- GCATACCATATCAGCTTCATGG -3'
(R):5'- CTAGGAAGTGCGGAATTAGCTCTTTC -3'

Posted On

2018-05-21