Incidental Mutation 'R6465:Bfsp1'
ID517764
Institutional Source Beutler Lab
Gene Symbol Bfsp1
Ensembl Gene ENSMUSG00000027420
Gene Namebeaded filament structural protein 1, in lens-CP94
Synonymsfilensin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R6465 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location143826528-143863173 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to C at 143858055 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000096899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028907] [ENSMUST00000099296]
Predicted Effect probably null
Transcript: ENSMUST00000028907
SMART Domains Protein: ENSMUSP00000028907
Gene: ENSMUSG00000027420

DomainStartEndE-ValueType
Pfam:Filament 34 205 2.5e-13 PFAM
low complexity region 400 411 N/A INTRINSIC
low complexity region 544 561 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000099296
SMART Domains Protein: ENSMUSP00000096899
Gene: ENSMUSG00000027420

DomainStartEndE-ValueType
Filament 32 317 1.05e-6 SMART
low complexity region 406 417 N/A INTRINSIC
low complexity region 550 567 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120038
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lens-specific intermediate filament-like protein named filensin. The encoded protein is expressed in lens fiber cells after differentiation has begun. This protein functions as a component of the beaded filament which is a cytoskeletal structure found in lens fiber cells. Mutations in this gene are the cause of autosomal recessive cortical juvenile-onset cataract. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mutations in this gene produce lens abnormalities progressing to cataracts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230113P08Rik A T 9: 35,908,625 N25Y possibly damaging Het
A2ml1 G A 6: 128,541,078 T1415I probably damaging Het
Acvr2b T A 9: 119,433,303 W461R probably damaging Het
Adam23 G T 1: 63,566,668 C637F probably damaging Het
Apol8 T G 15: 77,749,948 T143P probably benign Het
Asna1 A T 8: 85,018,565 M291K probably benign Het
Cytl1 T C 5: 37,737,670 V99A probably benign Het
Dock2 A T 11: 34,503,413 V793E probably damaging Het
Fxyd5 G T 7: 31,037,880 T81K probably damaging Het
Gcm1 A G 9: 78,064,869 Y364C probably damaging Het
Gm37596 A G 3: 93,692,996 I22T probably damaging Het
Gm9992 G T 17: 7,374,443 T202K probably damaging Het
Haghl T C 17: 25,783,819 N190S possibly damaging Het
Inpp5j C A 11: 3,502,293 R319L possibly damaging Het
Ints10 A G 8: 68,807,536 N304S probably benign Het
Isoc1 T A 18: 58,671,256 C119S probably damaging Het
Klhl18 A G 9: 110,428,920 M414T probably benign Het
Krtap2-4 A G 11: 99,614,759 probably benign Het
Krtap3-1 G A 11: 99,566,451 P45S possibly damaging Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Myo7a A G 7: 98,062,680 V1754A possibly damaging Het
Nedd4l T A 18: 65,155,264 D119E probably benign Het
Nsun7 T C 5: 66,295,586 V548A probably benign Het
Olfr1024 A T 2: 85,904,539 S172T probably benign Het
Olfr711 A T 7: 106,972,212 V44E possibly damaging Het
Parvg A G 15: 84,328,940 D127G probably damaging Het
Piezo2 T A 18: 63,041,663 M2007L possibly damaging Het
Pou2f3 A C 9: 43,139,867 F175V probably damaging Het
Ptprn2 T C 12: 117,269,589 I958T probably damaging Het
Pwwp2b T C 7: 139,256,035 V464A probably benign Het
Pzp A G 6: 128,491,619 Y982H probably damaging Het
Rad17 T A 13: 100,637,080 N202I probably benign Het
Rtel1 T A 2: 181,335,940 D271E possibly damaging Het
Sos2 T C 12: 69,596,775 S943G probably benign Het
Tm9sf2 A G 14: 122,141,207 H241R probably benign Het
Ttc8 A G 12: 98,964,570 E291G probably damaging Het
Wfikkn1 A G 17: 25,878,718 C211R probably damaging Het
Ylpm1 T A 12: 85,049,802 D1219E probably damaging Het
Zc3hav1 T C 6: 38,331,849 Y586C possibly damaging Het
Zcchc4 T A 5: 52,819,276 F471I probably benign Het
Zfp719 C A 7: 43,590,684 Y565* probably null Het
Other mutations in Bfsp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Bfsp1 APN 2 143831892 missense probably damaging 1.00
IGL01457:Bfsp1 APN 2 143827644 splice site probably benign
IGL02329:Bfsp1 APN 2 143862646 missense probably benign
IGL02354:Bfsp1 APN 2 143831987 missense probably damaging 1.00
IGL02361:Bfsp1 APN 2 143831987 missense probably damaging 1.00
IGL02365:Bfsp1 APN 2 143826736 missense probably damaging 1.00
IGL02407:Bfsp1 APN 2 143826933 missense probably benign 0.00
IGL03118:Bfsp1 APN 2 143827333 missense possibly damaging 0.94
I0000:Bfsp1 UTSW 2 143845968 missense probably damaging 1.00
R0112:Bfsp1 UTSW 2 143827643 splice site probably null
R0657:Bfsp1 UTSW 2 143827650 splice site probably benign
R1642:Bfsp1 UTSW 2 143841763 missense probably damaging 1.00
R1816:Bfsp1 UTSW 2 143841679 missense probably benign 0.23
R2061:Bfsp1 UTSW 2 143862678 missense probably benign 0.08
R2248:Bfsp1 UTSW 2 143827652 splice site probably null
R3024:Bfsp1 UTSW 2 143845959 missense probably benign 0.19
R4029:Bfsp1 UTSW 2 143831829 splice site probably benign
R4914:Bfsp1 UTSW 2 143827471 missense probably benign 0.21
R4915:Bfsp1 UTSW 2 143827471 missense probably benign 0.21
R4917:Bfsp1 UTSW 2 143827471 missense probably benign 0.21
R4918:Bfsp1 UTSW 2 143827471 missense probably benign 0.21
R5018:Bfsp1 UTSW 2 143862882 missense possibly damaging 0.81
R5202:Bfsp1 UTSW 2 143826971 missense probably benign
R5267:Bfsp1 UTSW 2 143827051 missense probably benign 0.03
R5304:Bfsp1 UTSW 2 143827291 missense probably benign 0.34
R5825:Bfsp1 UTSW 2 143827459 missense probably benign 0.01
R6888:Bfsp1 UTSW 2 143826719 missense probably benign 0.31
R7036:Bfsp1 UTSW 2 143826923 missense possibly damaging 0.65
R7075:Bfsp1 UTSW 2 143848965 missense probably damaging 1.00
R7362:Bfsp1 UTSW 2 143826875 missense probably benign 0.19
R7538:Bfsp1 UTSW 2 143831835 critical splice donor site probably null
R7839:Bfsp1 UTSW 2 143831850 missense possibly damaging 0.79
R7922:Bfsp1 UTSW 2 143831850 missense possibly damaging 0.79
X0022:Bfsp1 UTSW 2 143858117 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTCAACATACCTAGCATACC -3'
(R):5'- ATTATTGGGAAGCAGTGGGC -3'

Sequencing Primer
(F):5'- GCATACCATATCAGCTTCATGG -3'
(R):5'- CTAGGAAGTGCGGAATTAGCTCTTTC -3'
Posted On2018-05-21