Incidental Mutation 'R6465:Cytl1'
ID517767
Institutional Source Beutler Lab
Gene Symbol Cytl1
Ensembl Gene ENSMUSG00000062329
Gene Namecytokine-like 1
SynonymsC17, 4930443F05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6465 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location37735519-37739820 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37737670 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 99 (V99A)
Ref Sequence ENSEMBL: ENSMUSP00000073244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073554]
Predicted Effect probably benign
Transcript: ENSMUST00000073554
AA Change: V99A

PolyPhen 2 Score 0.338 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000073244
Gene: ENSMUSG00000062329
AA Change: V99A

DomainStartEndE-ValueType
Pfam:CYTL1 6 136 4.3e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201048
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] C17 is a cytokine-like protein specifically expressed in bone marrow and cord blood mononuclear cells that bear the CD34 (MIM 142230) surface marker (Liu et al., 2000 [PubMed 10857752]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to osteoarthritic cartilage destruction following destabilization of the medial meniscus surgery. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230113P08Rik A T 9: 35,908,625 N25Y possibly damaging Het
A2ml1 G A 6: 128,541,078 T1415I probably damaging Het
Acvr2b T A 9: 119,433,303 W461R probably damaging Het
Adam23 G T 1: 63,566,668 C637F probably damaging Het
Apol8 T G 15: 77,749,948 T143P probably benign Het
Asna1 A T 8: 85,018,565 M291K probably benign Het
Bfsp1 A C 2: 143,858,055 probably null Het
Dock2 A T 11: 34,503,413 V793E probably damaging Het
Fxyd5 G T 7: 31,037,880 T81K probably damaging Het
Gcm1 A G 9: 78,064,869 Y364C probably damaging Het
Gm37596 A G 3: 93,692,996 I22T probably damaging Het
Gm9992 G T 17: 7,374,443 T202K probably damaging Het
Haghl T C 17: 25,783,819 N190S possibly damaging Het
Inpp5j C A 11: 3,502,293 R319L possibly damaging Het
Ints10 A G 8: 68,807,536 N304S probably benign Het
Isoc1 T A 18: 58,671,256 C119S probably damaging Het
Klhl18 A G 9: 110,428,920 M414T probably benign Het
Krtap2-4 A G 11: 99,614,759 probably benign Het
Krtap3-1 G A 11: 99,566,451 P45S possibly damaging Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Myo7a A G 7: 98,062,680 V1754A possibly damaging Het
Nedd4l T A 18: 65,155,264 D119E probably benign Het
Nsun7 T C 5: 66,295,586 V548A probably benign Het
Olfr1024 A T 2: 85,904,539 S172T probably benign Het
Olfr711 A T 7: 106,972,212 V44E possibly damaging Het
Parvg A G 15: 84,328,940 D127G probably damaging Het
Piezo2 T A 18: 63,041,663 M2007L possibly damaging Het
Pou2f3 A C 9: 43,139,867 F175V probably damaging Het
Ptprn2 T C 12: 117,269,589 I958T probably damaging Het
Pwwp2b T C 7: 139,256,035 V464A probably benign Het
Pzp A G 6: 128,491,619 Y982H probably damaging Het
Rad17 T A 13: 100,637,080 N202I probably benign Het
Rtel1 T A 2: 181,335,940 D271E possibly damaging Het
Sos2 T C 12: 69,596,775 S943G probably benign Het
Tm9sf2 A G 14: 122,141,207 H241R probably benign Het
Ttc8 A G 12: 98,964,570 E291G probably damaging Het
Wfikkn1 A G 17: 25,878,718 C211R probably damaging Het
Ylpm1 T A 12: 85,049,802 D1219E probably damaging Het
Zc3hav1 T C 6: 38,331,849 Y586C possibly damaging Het
Zcchc4 T A 5: 52,819,276 F471I probably benign Het
Zfp719 C A 7: 43,590,684 Y565* probably null Het
Other mutations in Cytl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1469:Cytl1 UTSW 5 37735647 missense probably benign 0.01
R1469:Cytl1 UTSW 5 37735647 missense probably benign 0.01
R4073:Cytl1 UTSW 5 37735596 missense unknown
R4074:Cytl1 UTSW 5 37735596 missense unknown
R4130:Cytl1 UTSW 5 37735641 missense probably damaging 1.00
R4888:Cytl1 UTSW 5 37735574 missense unknown
Z1176:Cytl1 UTSW 5 37735695 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- GATGTTAGGGGACTCATGAGCTC -3'
(R):5'- AAGTGTCCTCTGGCTACCTC -3'

Sequencing Primer
(F):5'- TAGGGGACTCATGAGCTCAGTCTC -3'
(R):5'- CTCCATGTGCAGCTATGGGAG -3'
Posted On2018-05-21