Incidental Mutation 'R6465:Zcchc4'
ID517768
Institutional Source Beutler Lab
Gene Symbol Zcchc4
Ensembl Gene ENSMUSG00000029179
Gene Namezinc finger, CCHC domain containing 4
Synonyms4930449I23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R6465 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location52775409-52824665 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 52819276 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 471 (F471I)
Ref Sequence ENSEMBL: ENSMUSP00000031077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031077] [ENSMUST00000113904]
Predicted Effect probably benign
Transcript: ENSMUST00000031077
AA Change: F471I

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000031077
Gene: ENSMUSG00000029179
AA Change: F471I

DomainStartEndE-ValueType
Pfam:zf-GRF 37 81 2.9e-19 PFAM
Pfam:N6-adenineMlase 168 337 5.1e-11 PFAM
ZnF_C2HC 442 458 1.27e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000113901
SMART Domains Protein: ENSMUSP00000109534
Gene: ENSMUSG00000029179

DomainStartEndE-ValueType
ZnF_C2HC 226 242 1.27e-2 SMART
low complexity region 248 266 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113904
SMART Domains Protein: ENSMUSP00000109537
Gene: ENSMUSG00000029179

DomainStartEndE-ValueType
Pfam:zf-GRF 37 81 2.4e-17 PFAM
Pfam:N6-adenineMlase 168 338 7.1e-11 PFAM
ZnF_C2HC 442 458 1.27e-2 SMART
low complexity region 464 482 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143745
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149612
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 95% (40/42)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230113P08Rik A T 9: 35,908,625 N25Y possibly damaging Het
A2ml1 G A 6: 128,541,078 T1415I probably damaging Het
Acvr2b T A 9: 119,433,303 W461R probably damaging Het
Adam23 G T 1: 63,566,668 C637F probably damaging Het
Apol8 T G 15: 77,749,948 T143P probably benign Het
Asna1 A T 8: 85,018,565 M291K probably benign Het
Bfsp1 A C 2: 143,858,055 probably null Het
Cytl1 T C 5: 37,737,670 V99A probably benign Het
Dock2 A T 11: 34,503,413 V793E probably damaging Het
Fxyd5 G T 7: 31,037,880 T81K probably damaging Het
Gcm1 A G 9: 78,064,869 Y364C probably damaging Het
Gm37596 A G 3: 93,692,996 I22T probably damaging Het
Gm9992 G T 17: 7,374,443 T202K probably damaging Het
Haghl T C 17: 25,783,819 N190S possibly damaging Het
Inpp5j C A 11: 3,502,293 R319L possibly damaging Het
Ints10 A G 8: 68,807,536 N304S probably benign Het
Isoc1 T A 18: 58,671,256 C119S probably damaging Het
Klhl18 A G 9: 110,428,920 M414T probably benign Het
Krtap2-4 A G 11: 99,614,759 probably benign Het
Krtap3-1 G A 11: 99,566,451 P45S possibly damaging Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Myo7a A G 7: 98,062,680 V1754A possibly damaging Het
Nedd4l T A 18: 65,155,264 D119E probably benign Het
Nsun7 T C 5: 66,295,586 V548A probably benign Het
Olfr1024 A T 2: 85,904,539 S172T probably benign Het
Olfr711 A T 7: 106,972,212 V44E possibly damaging Het
Parvg A G 15: 84,328,940 D127G probably damaging Het
Piezo2 T A 18: 63,041,663 M2007L possibly damaging Het
Pou2f3 A C 9: 43,139,867 F175V probably damaging Het
Ptprn2 T C 12: 117,269,589 I958T probably damaging Het
Pwwp2b T C 7: 139,256,035 V464A probably benign Het
Pzp A G 6: 128,491,619 Y982H probably damaging Het
Rad17 T A 13: 100,637,080 N202I probably benign Het
Rtel1 T A 2: 181,335,940 D271E possibly damaging Het
Sos2 T C 12: 69,596,775 S943G probably benign Het
Tm9sf2 A G 14: 122,141,207 H241R probably benign Het
Ttc8 A G 12: 98,964,570 E291G probably damaging Het
Wfikkn1 A G 17: 25,878,718 C211R probably damaging Het
Ylpm1 T A 12: 85,049,802 D1219E probably damaging Het
Zc3hav1 T C 6: 38,331,849 Y586C possibly damaging Het
Zfp719 C A 7: 43,590,684 Y565* probably null Het
Other mutations in Zcchc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Zcchc4 APN 5 52816169 missense probably benign 0.05
IGL00953:Zcchc4 APN 5 52808296 missense probably damaging 1.00
IGL01860:Zcchc4 APN 5 52808356 missense probably damaging 1.00
IGL02248:Zcchc4 APN 5 52796076 missense probably damaging 1.00
IGL02536:Zcchc4 APN 5 52808316 missense probably damaging 1.00
R0060:Zcchc4 UTSW 5 52807078 missense possibly damaging 0.67
R0060:Zcchc4 UTSW 5 52807078 missense possibly damaging 0.67
R0573:Zcchc4 UTSW 5 52795979 missense probably damaging 1.00
R0634:Zcchc4 UTSW 5 52783208 missense probably benign 0.15
R1353:Zcchc4 UTSW 5 52807077 missense probably benign 0.03
R1791:Zcchc4 UTSW 5 52796590 missense probably damaging 1.00
R1854:Zcchc4 UTSW 5 52815826 missense probably damaging 1.00
R2108:Zcchc4 UTSW 5 52796132 missense probably damaging 0.99
R2696:Zcchc4 UTSW 5 52796231 missense probably damaging 1.00
R2991:Zcchc4 UTSW 5 52804438 missense probably damaging 1.00
R3894:Zcchc4 UTSW 5 52784100 missense probably damaging 1.00
R4523:Zcchc4 UTSW 5 52784067 missense probably damaging 1.00
R4672:Zcchc4 UTSW 5 52796605 missense probably benign 0.00
R4772:Zcchc4 UTSW 5 52796207 missense possibly damaging 0.83
R4905:Zcchc4 UTSW 5 52796650 missense probably damaging 1.00
R4954:Zcchc4 UTSW 5 52819217 missense probably damaging 1.00
R5093:Zcchc4 UTSW 5 52796610 missense probably benign 0.38
R5371:Zcchc4 UTSW 5 52785170 missense probably benign 0.19
R5401:Zcchc4 UTSW 5 52807077 missense probably benign 0.03
R5755:Zcchc4 UTSW 5 52816169 missense probably benign 0.00
R6110:Zcchc4 UTSW 5 52796144 missense possibly damaging 0.95
R6244:Zcchc4 UTSW 5 52783161 missense probably benign 0.00
R6906:Zcchc4 UTSW 5 52823634 missense possibly damaging 0.66
R7019:Zcchc4 UTSW 5 52784033 missense probably benign 0.00
R7363:Zcchc4 UTSW 5 52785168 missense possibly damaging 0.88
R7643:Zcchc4 UTSW 5 52808293 missense possibly damaging 0.85
R8097:Zcchc4 UTSW 5 52795991 missense probably benign 0.34
R8158:Zcchc4 UTSW 5 52815918 missense probably damaging 1.00
R8372:Zcchc4 UTSW 5 52796164 missense probably damaging 1.00
R8545:Zcchc4 UTSW 5 52819399 intron probably benign
R8755:Zcchc4 UTSW 5 52819382 missense unknown
Predicted Primers PCR Primer
(F):5'- AACCTCTTCTGAAACTTGGGTTTTC -3'
(R):5'- GTCCTGTGTGAAAGCTGTCAAG -3'

Sequencing Primer
(F):5'- GAAACTTGGGTTTTCTTTTACAGCC -3'
(R):5'- AAGCTGTCAAGGCAGGACTCC -3'
Posted On2018-05-21