Incidental Mutation 'R6465:Fxyd5'
ID517772
Institutional Source Beutler Lab
Gene Symbol Fxyd5
Ensembl Gene ENSMUSG00000009687
Gene NameFXYD domain-containing ion transport regulator 5
SynonymsEF-8, Oit2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6465 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location31032722-31042481 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 31037880 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 81 (T81K)
Ref Sequence ENSEMBL: ENSMUSP00000124203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009831] [ENSMUST00000073892] [ENSMUST00000159753] [ENSMUST00000159924] [ENSMUST00000160689] [ENSMUST00000161684] [ENSMUST00000161805] [ENSMUST00000162087] [ENSMUST00000162116] [ENSMUST00000162733] [ENSMUST00000202395] [ENSMUST00000206341]
Predicted Effect probably damaging
Transcript: ENSMUST00000009831
AA Change: T82K

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000009831
Gene: ENSMUSG00000009687
AA Change: T82K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 80 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 130 176 8.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073892
SMART Domains Protein: ENSMUSP00000073555
Gene: ENSMUSG00000036578

DomainStartEndE-ValueType
Pfam:ATP1G1_PLM_MAT8 13 60 1.2e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000159753
AA Change: T82K

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123813
Gene: ENSMUSG00000009687
AA Change: T82K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 80 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159924
AA Change: T81K

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124219
Gene: ENSMUSG00000009687
AA Change: T81K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 129 175 8.5e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160006
Predicted Effect possibly damaging
Transcript: ENSMUST00000160689
AA Change: T87K

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125187
Gene: ENSMUSG00000009687
AA Change: T87K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 69 85 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161259
Predicted Effect probably damaging
Transcript: ENSMUST00000161684
AA Change: T81K

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125285
Gene: ENSMUSG00000009687
AA Change: T81K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 129 175 8.5e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161805
AA Change: T81K

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125398
Gene: ENSMUSG00000009687
AA Change: T81K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 129 175 8.5e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162087
AA Change: T81K

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125065
Gene: ENSMUSG00000009687
AA Change: T81K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 130 174 1.5e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162116
AA Change: T81K

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124203
Gene: ENSMUSG00000009687
AA Change: T81K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 129 175 8.5e-22 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000162250
AA Change: T19K
SMART Domains Protein: ENSMUSP00000124129
Gene: ENSMUSG00000009687
AA Change: T19K

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 69 113 7.5e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000162733
AA Change: T82K

PolyPhen 2 Score 0.793 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125173
Gene: ENSMUSG00000009687
AA Change: T82K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 80 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 131 167 6.5e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184636
Predicted Effect possibly damaging
Transcript: ENSMUST00000202395
AA Change: T69K

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144377
Gene: ENSMUSG00000009687
AA Change: T69K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 52 67 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205301
Predicted Effect probably benign
Transcript: ENSMUST00000206341
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: This gene encodes a precursor protein that is member of the FXYD family of transmembrane glycoproteins. Like most members of the FXYD family, the encoded protein is a subunit of the sodium-potassium adenosine triphosphatase pump. FXYD family members have tissue-specific expression and differentially regulate the activity of this pump. The protein encoded by this gene also plays a role in cell adhesion and motility. The orthologous human protein inhibits epithelial cadherin, a calcium-dependent adhesion protein and is associated with cancer (promotes metastasis). Alternative splicing of this mouse gene results in multiple transcript variants. [provided by RefSeq, Dec 2013]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230113P08Rik A T 9: 35,908,625 N25Y possibly damaging Het
A2ml1 G A 6: 128,541,078 T1415I probably damaging Het
Acvr2b T A 9: 119,433,303 W461R probably damaging Het
Adam23 G T 1: 63,566,668 C637F probably damaging Het
Apol8 T G 15: 77,749,948 T143P probably benign Het
Asna1 A T 8: 85,018,565 M291K probably benign Het
Bfsp1 A C 2: 143,858,055 probably null Het
Cytl1 T C 5: 37,737,670 V99A probably benign Het
Dock2 A T 11: 34,503,413 V793E probably damaging Het
Gcm1 A G 9: 78,064,869 Y364C probably damaging Het
Gm37596 A G 3: 93,692,996 I22T probably damaging Het
Gm9992 G T 17: 7,374,443 T202K probably damaging Het
Haghl T C 17: 25,783,819 N190S possibly damaging Het
Inpp5j C A 11: 3,502,293 R319L possibly damaging Het
Ints10 A G 8: 68,807,536 N304S probably benign Het
Isoc1 T A 18: 58,671,256 C119S probably damaging Het
Klhl18 A G 9: 110,428,920 M414T probably benign Het
Krtap2-4 A G 11: 99,614,759 probably benign Het
Krtap3-1 G A 11: 99,566,451 P45S possibly damaging Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Myo7a A G 7: 98,062,680 V1754A possibly damaging Het
Nedd4l T A 18: 65,155,264 D119E probably benign Het
Nsun7 T C 5: 66,295,586 V548A probably benign Het
Olfr1024 A T 2: 85,904,539 S172T probably benign Het
Olfr711 A T 7: 106,972,212 V44E possibly damaging Het
Parvg A G 15: 84,328,940 D127G probably damaging Het
Piezo2 T A 18: 63,041,663 M2007L possibly damaging Het
Pou2f3 A C 9: 43,139,867 F175V probably damaging Het
Ptprn2 T C 12: 117,269,589 I958T probably damaging Het
Pwwp2b T C 7: 139,256,035 V464A probably benign Het
Pzp A G 6: 128,491,619 Y982H probably damaging Het
Rad17 T A 13: 100,637,080 N202I probably benign Het
Rtel1 T A 2: 181,335,940 D271E possibly damaging Het
Sos2 T C 12: 69,596,775 S943G probably benign Het
Tm9sf2 A G 14: 122,141,207 H241R probably benign Het
Ttc8 A G 12: 98,964,570 E291G probably damaging Het
Wfikkn1 A G 17: 25,878,718 C211R probably damaging Het
Ylpm1 T A 12: 85,049,802 D1219E probably damaging Het
Zc3hav1 T C 6: 38,331,849 Y586C possibly damaging Het
Zcchc4 T A 5: 52,819,276 F471I probably benign Het
Zfp719 C A 7: 43,590,684 Y565* probably null Het
Other mutations in Fxyd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01910:Fxyd5 APN 7 31035218 missense probably damaging 0.96
IGL01913:Fxyd5 APN 7 31035212 missense probably damaging 0.99
IGL02071:Fxyd5 APN 7 31040188 missense possibly damaging 0.46
IGL02800:Fxyd5 APN 7 31032979 missense possibly damaging 0.95
R1812:Fxyd5 UTSW 7 31037930 critical splice acceptor site probably null
R2362:Fxyd5 UTSW 7 31036471 missense probably benign 0.00
R3690:Fxyd5 UTSW 7 31036439 missense possibly damaging 0.95
R4279:Fxyd5 UTSW 7 31035386 missense probably null 1.00
R4786:Fxyd5 UTSW 7 31041482 unclassified probably benign
R6410:Fxyd5 UTSW 7 31035406 missense probably damaging 1.00
R7257:Fxyd5 UTSW 7 31035151 missense unknown
R7309:Fxyd5 UTSW 7 31035404 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGACTTTAACCCAGAATCCTCC -3'
(R):5'- TCACCTGGTATTTCAGCCTGG -3'

Sequencing Primer
(F):5'- TTTAACCCAGAATCCTCCAAACATC -3'
(R):5'- ACCTGGTATTTCAGCCTGGAATAC -3'
Posted On2018-05-21