Incidental Mutation 'R6465:Zfp719'
ID517773
Institutional Source Beutler Lab
Gene Symbol Zfp719
Ensembl Gene ENSMUSG00000030469
Gene Namezinc finger protein 719
Synonyms9430094P17Rik, mszf6, C630016O21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6465 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location43579610-43593235 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 43590684 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 565 (Y565*)
Ref Sequence ENSEMBL: ENSMUSP00000050968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058104] [ENSMUST00000205769]
Predicted Effect probably null
Transcript: ENSMUST00000058104
AA Change: Y565*
SMART Domains Protein: ENSMUSP00000050968
Gene: ENSMUSG00000030469
AA Change: Y565*

DomainStartEndE-ValueType
KRAB 49 109 1.18e-20 SMART
ZnF_C2H2 285 305 4.16e1 SMART
ZnF_C2H2 341 363 1.2e-3 SMART
ZnF_C2H2 369 391 9.08e-4 SMART
ZnF_C2H2 397 419 6.67e-2 SMART
ZnF_C2H2 425 447 7.9e-4 SMART
ZnF_C2H2 453 475 3.34e-2 SMART
ZnF_C2H2 481 503 1.38e-3 SMART
ZnF_C2H2 509 531 5.42e-2 SMART
ZnF_C2H2 537 559 3.78e-1 SMART
ZnF_C2H2 565 587 2.43e-4 SMART
ZnF_C2H2 593 615 4.54e-4 SMART
ZnF_C2H2 621 643 4.24e-4 SMART
ZnF_C2H2 649 671 6.42e-4 SMART
ZnF_C2H2 677 699 1.47e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205769
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 95% (40/42)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230113P08Rik A T 9: 35,908,625 N25Y possibly damaging Het
A2ml1 G A 6: 128,541,078 T1415I probably damaging Het
Acvr2b T A 9: 119,433,303 W461R probably damaging Het
Adam23 G T 1: 63,566,668 C637F probably damaging Het
Apol8 T G 15: 77,749,948 T143P probably benign Het
Asna1 A T 8: 85,018,565 M291K probably benign Het
Bfsp1 A C 2: 143,858,055 probably null Het
Cytl1 T C 5: 37,737,670 V99A probably benign Het
Dock2 A T 11: 34,503,413 V793E probably damaging Het
Fxyd5 G T 7: 31,037,880 T81K probably damaging Het
Gcm1 A G 9: 78,064,869 Y364C probably damaging Het
Gm37596 A G 3: 93,692,996 I22T probably damaging Het
Gm9992 G T 17: 7,374,443 T202K probably damaging Het
Haghl T C 17: 25,783,819 N190S possibly damaging Het
Inpp5j C A 11: 3,502,293 R319L possibly damaging Het
Ints10 A G 8: 68,807,536 N304S probably benign Het
Isoc1 T A 18: 58,671,256 C119S probably damaging Het
Klhl18 A G 9: 110,428,920 M414T probably benign Het
Krtap2-4 A G 11: 99,614,759 probably benign Het
Krtap3-1 G A 11: 99,566,451 P45S possibly damaging Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Myo7a A G 7: 98,062,680 V1754A possibly damaging Het
Nedd4l T A 18: 65,155,264 D119E probably benign Het
Nsun7 T C 5: 66,295,586 V548A probably benign Het
Olfr1024 A T 2: 85,904,539 S172T probably benign Het
Olfr711 A T 7: 106,972,212 V44E possibly damaging Het
Parvg A G 15: 84,328,940 D127G probably damaging Het
Piezo2 T A 18: 63,041,663 M2007L possibly damaging Het
Pou2f3 A C 9: 43,139,867 F175V probably damaging Het
Ptprn2 T C 12: 117,269,589 I958T probably damaging Het
Pwwp2b T C 7: 139,256,035 V464A probably benign Het
Pzp A G 6: 128,491,619 Y982H probably damaging Het
Rad17 T A 13: 100,637,080 N202I probably benign Het
Rtel1 T A 2: 181,335,940 D271E possibly damaging Het
Sos2 T C 12: 69,596,775 S943G probably benign Het
Tm9sf2 A G 14: 122,141,207 H241R probably benign Het
Ttc8 A G 12: 98,964,570 E291G probably damaging Het
Wfikkn1 A G 17: 25,878,718 C211R probably damaging Het
Ylpm1 T A 12: 85,049,802 D1219E probably damaging Het
Zc3hav1 T C 6: 38,331,849 Y586C possibly damaging Het
Zcchc4 T A 5: 52,819,276 F471I probably benign Het
Other mutations in Zfp719
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01392:Zfp719 APN 7 43591130 missense probably damaging 1.00
IGL01407:Zfp719 APN 7 43584187 missense probably benign 0.00
IGL01763:Zfp719 APN 7 43584189 missense probably benign 0.00
IGL03079:Zfp719 APN 7 43591166 missense probably damaging 1.00
R0522:Zfp719 UTSW 7 43589253 critical splice acceptor site probably null
R0524:Zfp719 UTSW 7 43589253 critical splice acceptor site probably null
R0542:Zfp719 UTSW 7 43589253 critical splice acceptor site probably null
R0543:Zfp719 UTSW 7 43589253 critical splice acceptor site probably null
R0662:Zfp719 UTSW 7 43584254 missense possibly damaging 0.56
R1390:Zfp719 UTSW 7 43590443 missense possibly damaging 0.69
R2959:Zfp719 UTSW 7 43590427 missense possibly damaging 0.89
R4708:Zfp719 UTSW 7 43590232 missense probably damaging 1.00
R4709:Zfp719 UTSW 7 43590232 missense probably damaging 1.00
R4710:Zfp719 UTSW 7 43590232 missense probably damaging 1.00
R4716:Zfp719 UTSW 7 43591111 missense possibly damaging 0.80
R4729:Zfp719 UTSW 7 43590410 missense probably damaging 1.00
R4755:Zfp719 UTSW 7 43590793 missense probably damaging 1.00
R5176:Zfp719 UTSW 7 43591125 missense probably damaging 1.00
R5949:Zfp719 UTSW 7 43584117 intron probably benign
R6063:Zfp719 UTSW 7 43589626 nonsense probably null
R6363:Zfp719 UTSW 7 43589866 missense probably benign 0.03
R6434:Zfp719 UTSW 7 43590988 missense probably damaging 1.00
R6806:Zfp719 UTSW 7 43586385 missense possibly damaging 0.63
R6925:Zfp719 UTSW 7 43590706 missense probably damaging 1.00
R8124:Zfp719 UTSW 7 43589890 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGACTGTGGAATGGCCTTCAG -3'
(R):5'- ACTTATCACTGAAGGCCTTCC -3'

Sequencing Primer
(F):5'- TTCACAGTGGAGAGAAATGTTACCC -3'
(R):5'- TGTGCTGAGAACTGACCTATC -3'
Posted On2018-05-21