Incidental Mutation 'R6465:Myo7a'
ID517774
Institutional Source Beutler Lab
Gene Symbol Myo7a
Ensembl Gene ENSMUSG00000030761
Gene Namemyosin VIIA
SynonymsMyo7, nmf371, polka, Hdb, USH1B
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6465 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location98051060-98119524 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98062680 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1754 (V1754A)
Ref Sequence ENSEMBL: ENSMUSP00000102744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084979] [ENSMUST00000107122] [ENSMUST00000107127] [ENSMUST00000107128] [ENSMUST00000156992] [ENSMUST00000205746]
PDB Structure Structure of myosin VIIa MyTH4-FERM-SH3 in complex with the CEN1 of Sans [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000084979
AA Change: V1743A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000082046
Gene: ENSMUSG00000030761
AA Change: V1743A

DomainStartEndE-ValueType
MYSc 48 731 N/A SMART
IQ 732 754 2.99e0 SMART
IQ 755 777 8.77e-7 SMART
IQ 801 823 8e0 SMART
IQ 824 846 8.7e0 SMART
low complexity region 854 889 N/A INTRINSIC
low complexity region 893 916 N/A INTRINSIC
low complexity region 972 985 N/A INTRINSIC
MyTH4 1006 1242 1.4e-71 SMART
B41 1243 1458 8.82e-42 SMART
SH3 1557 1622 4.93e-7 SMART
MyTH4 1698 1847 3.95e-57 SMART
B41 1849 2066 8.27e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107122
AA Change: V1749A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102739
Gene: ENSMUSG00000030761
AA Change: V1749A

DomainStartEndE-ValueType
MYSc 48 737 N/A SMART
IQ 738 760 2.99e0 SMART
IQ 761 783 8.77e-7 SMART
IQ 807 829 8e0 SMART
IQ 830 852 8.7e0 SMART
low complexity region 860 895 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 978 991 N/A INTRINSIC
MyTH4 1012 1248 1.4e-71 SMART
B41 1249 1464 8.82e-42 SMART
SH3 1563 1628 4.93e-7 SMART
MyTH4 1704 1853 3.95e-57 SMART
B41 1855 2072 8.27e-56 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107127
AA Change: V1754A

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102744
Gene: ENSMUSG00000030761
AA Change: V1754A

DomainStartEndE-ValueType
MYSc 59 742 N/A SMART
IQ 743 765 2.99e0 SMART
IQ 766 788 8.77e-7 SMART
IQ 812 834 8e0 SMART
IQ 835 857 8.7e0 SMART
low complexity region 865 900 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
low complexity region 983 996 N/A INTRINSIC
MyTH4 1017 1253 1.4e-71 SMART
B41 1254 1469 8.82e-42 SMART
SH3 1568 1633 4.93e-7 SMART
MyTH4 1709 1858 3.95e-57 SMART
B41 1860 2077 8.27e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107128
AA Change: V1792A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000102745
Gene: ENSMUSG00000030761
AA Change: V1792A

DomainStartEndE-ValueType
MYSc 59 742 N/A SMART
IQ 743 765 2.99e0 SMART
IQ 766 788 8.77e-7 SMART
IQ 812 834 8e0 SMART
IQ 835 857 8.7e0 SMART
low complexity region 865 900 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
low complexity region 983 996 N/A INTRINSIC
MyTH4 1017 1253 1.4e-71 SMART
B41 1254 1469 8.82e-42 SMART
SH3 1606 1671 4.93e-7 SMART
MyTH4 1747 1896 3.95e-57 SMART
B41 1898 2115 8.27e-56 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124787
Predicted Effect probably benign
Transcript: ENSMUST00000156992
Predicted Effect possibly damaging
Transcript: ENSMUST00000205746
AA Change: V1743A

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myosin gene family. Myosins are mechanochemical proteins characterized by the presence of a motor domain, an actin-binding domain, a neck domain that interacts with other proteins, and a tail domain that serves as an anchor. This gene encodes an unconventional myosin with a very short tail. Defects in this gene are associated with the mouse shaker-1 phenotype and the human Usher syndrome 1B which are characterized by deafness, reduced vestibular function, and (in human) retinal degeneration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: A number of spontaneous and ENU-induced mutations cause head-shaking, circling and deafness, often associated with cochlear hair cell degeneration and stereocilia anomalies. Defects in retinal pigment epithelial cells, male infertility, and light-inducedphotoreceptor damage have also been observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230113P08Rik A T 9: 35,908,625 N25Y possibly damaging Het
A2ml1 G A 6: 128,541,078 T1415I probably damaging Het
Acvr2b T A 9: 119,433,303 W461R probably damaging Het
Adam23 G T 1: 63,566,668 C637F probably damaging Het
Apol8 T G 15: 77,749,948 T143P probably benign Het
Asna1 A T 8: 85,018,565 M291K probably benign Het
Bfsp1 A C 2: 143,858,055 probably null Het
Cytl1 T C 5: 37,737,670 V99A probably benign Het
Dock2 A T 11: 34,503,413 V793E probably damaging Het
Fxyd5 G T 7: 31,037,880 T81K probably damaging Het
Gcm1 A G 9: 78,064,869 Y364C probably damaging Het
Gm37596 A G 3: 93,692,996 I22T probably damaging Het
Gm9992 G T 17: 7,374,443 T202K probably damaging Het
Haghl T C 17: 25,783,819 N190S possibly damaging Het
Inpp5j C A 11: 3,502,293 R319L possibly damaging Het
Ints10 A G 8: 68,807,536 N304S probably benign Het
Isoc1 T A 18: 58,671,256 C119S probably damaging Het
Klhl18 A G 9: 110,428,920 M414T probably benign Het
Krtap2-4 A G 11: 99,614,759 probably benign Het
Krtap3-1 G A 11: 99,566,451 P45S possibly damaging Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Nedd4l T A 18: 65,155,264 D119E probably benign Het
Nsun7 T C 5: 66,295,586 V548A probably benign Het
Olfr1024 A T 2: 85,904,539 S172T probably benign Het
Olfr711 A T 7: 106,972,212 V44E possibly damaging Het
Parvg A G 15: 84,328,940 D127G probably damaging Het
Piezo2 T A 18: 63,041,663 M2007L possibly damaging Het
Pou2f3 A C 9: 43,139,867 F175V probably damaging Het
Ptprn2 T C 12: 117,269,589 I958T probably damaging Het
Pwwp2b T C 7: 139,256,035 V464A probably benign Het
Pzp A G 6: 128,491,619 Y982H probably damaging Het
Rad17 T A 13: 100,637,080 N202I probably benign Het
Rtel1 T A 2: 181,335,940 D271E possibly damaging Het
Sos2 T C 12: 69,596,775 S943G probably benign Het
Tm9sf2 A G 14: 122,141,207 H241R probably benign Het
Ttc8 A G 12: 98,964,570 E291G probably damaging Het
Wfikkn1 A G 17: 25,878,718 C211R probably damaging Het
Ylpm1 T A 12: 85,049,802 D1219E probably damaging Het
Zc3hav1 T C 6: 38,331,849 Y586C possibly damaging Het
Zcchc4 T A 5: 52,819,276 F471I probably benign Het
Zfp719 C A 7: 43,590,684 Y565* probably null Het
Other mutations in Myo7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Myo7a APN 7 98102626 missense probably damaging 1.00
IGL00785:Myo7a APN 7 98054348 missense probably damaging 0.99
IGL00840:Myo7a APN 7 98051659 missense probably benign 0.25
IGL01362:Myo7a APN 7 98097702 missense probably damaging 1.00
IGL01484:Myo7a APN 7 98085422 missense probably damaging 1.00
IGL01673:Myo7a APN 7 98054708 missense probably benign 0.00
IGL01933:Myo7a APN 7 98083142 missense probably damaging 1.00
IGL01943:Myo7a APN 7 98065647 missense possibly damaging 0.96
IGL02188:Myo7a APN 7 98091027 missense probably damaging 0.96
IGL02304:Myo7a APN 7 98077736 missense possibly damaging 0.89
IGL02305:Myo7a APN 7 98051629 makesense probably null
IGL02331:Myo7a APN 7 98053182 missense possibly damaging 0.95
IGL02386:Myo7a APN 7 98075112 missense probably damaging 0.99
IGL02389:Myo7a APN 7 98106991 critical splice donor site probably null
IGL02832:Myo7a APN 7 98091020 critical splice donor site probably null
IGL02839:Myo7a APN 7 98091122 missense probably damaging 1.00
IGL03193:Myo7a APN 7 98091057 missense probably damaging 1.00
IGL03237:Myo7a APN 7 98102593 missense probably damaging 1.00
IGL03384:Myo7a APN 7 98093593 missense probably damaging 1.00
coward UTSW 7 98085466 missense probably damaging 1.00
H8786:Myo7a UTSW 7 98095778 missense possibly damaging 0.61
IGL03046:Myo7a UTSW 7 98079327 missense probably damaging 1.00
IGL03134:Myo7a UTSW 7 98056767 missense probably damaging 0.96
PIT4696001:Myo7a UTSW 7 98063599 missense probably benign 0.00
R0054:Myo7a UTSW 7 98065698 missense probably damaging 1.00
R0054:Myo7a UTSW 7 98065698 missense probably damaging 1.00
R0071:Myo7a UTSW 7 98056830 missense probably damaging 0.98
R0071:Myo7a UTSW 7 98056830 missense probably damaging 0.98
R0267:Myo7a UTSW 7 98054624 missense probably benign 0.08
R0408:Myo7a UTSW 7 98056781 missense probably damaging 1.00
R0411:Myo7a UTSW 7 98071937 missense probably benign 0.00
R0540:Myo7a UTSW 7 98071946 missense probably damaging 1.00
R0607:Myo7a UTSW 7 98071946 missense probably damaging 1.00
R0629:Myo7a UTSW 7 98085466 missense probably damaging 1.00
R0632:Myo7a UTSW 7 98112150 intron probably benign
R0659:Myo7a UTSW 7 98054338 splice site probably benign
R0735:Myo7a UTSW 7 98081180 splice site probably benign
R0924:Myo7a UTSW 7 98098256 missense probably damaging 0.99
R0930:Myo7a UTSW 7 98098256 missense probably damaging 0.99
R1018:Myo7a UTSW 7 98107005 missense probably damaging 1.00
R1196:Myo7a UTSW 7 98097673 missense possibly damaging 0.87
R1331:Myo7a UTSW 7 98107008 missense probably benign 0.00
R1487:Myo7a UTSW 7 98053810 critical splice donor site probably null
R1676:Myo7a UTSW 7 98099472 critical splice donor site probably null
R1695:Myo7a UTSW 7 98092496 missense possibly damaging 0.94
R1770:Myo7a UTSW 7 98112606 intron probably benign
R1781:Myo7a UTSW 7 98073124 missense probably damaging 1.00
R1789:Myo7a UTSW 7 98107095 missense probably damaging 0.99
R1827:Myo7a UTSW 7 98076731 missense probably damaging 0.99
R1864:Myo7a UTSW 7 98052256 missense probably damaging 1.00
R1955:Myo7a UTSW 7 98054921 missense probably damaging 1.00
R2011:Myo7a UTSW 7 98054708 missense possibly damaging 0.69
R2229:Myo7a UTSW 7 98054910 missense probably benign 0.12
R2259:Myo7a UTSW 7 98069499 missense probably damaging 1.00
R2443:Myo7a UTSW 7 98095769 missense probably benign 0.07
R2898:Myo7a UTSW 7 98054424 nonsense probably null
R2898:Myo7a UTSW 7 98097206 missense probably damaging 1.00
R3158:Myo7a UTSW 7 98052292 missense probably damaging 1.00
R3408:Myo7a UTSW 7 98081087 missense probably benign 0.00
R4222:Myo7a UTSW 7 98073229 missense possibly damaging 0.93
R4255:Myo7a UTSW 7 98071964 missense probably damaging 0.96
R4374:Myo7a UTSW 7 98102674 missense probably damaging 1.00
R4429:Myo7a UTSW 7 98053188 missense probably damaging 0.99
R4445:Myo7a UTSW 7 98066404 missense probably damaging 1.00
R4579:Myo7a UTSW 7 98073193 missense probably damaging 1.00
R4659:Myo7a UTSW 7 98085466 missense probably damaging 1.00
R5073:Myo7a UTSW 7 98073218 nonsense probably null
R5138:Myo7a UTSW 7 98083599 missense probably damaging 1.00
R5566:Myo7a UTSW 7 98064816 missense possibly damaging 0.93
R5580:Myo7a UTSW 7 98073160 missense probably damaging 1.00
R6079:Myo7a UTSW 7 98065790 nonsense probably null
R6138:Myo7a UTSW 7 98065790 nonsense probably null
R6451:Myo7a UTSW 7 98073167 missense probably benign 0.01
R6452:Myo7a UTSW 7 98073167 missense probably benign 0.01
R6453:Myo7a UTSW 7 98073167 missense probably benign 0.01
R6454:Myo7a UTSW 7 98073167 missense probably benign 0.01
R6455:Myo7a UTSW 7 98073167 missense probably benign 0.01
R6653:Myo7a UTSW 7 98054503 missense probably damaging 0.96
R6709:Myo7a UTSW 7 98054699 missense probably damaging 1.00
R6917:Myo7a UTSW 7 98095763 missense possibly damaging 0.58
R7313:Myo7a UTSW 7 98064195 missense probably damaging 0.99
R7334:Myo7a UTSW 7 98079366 missense probably benign
R7356:Myo7a UTSW 7 98102683 missense probably benign 0.01
R7393:Myo7a UTSW 7 98063699 missense possibly damaging 0.91
R7422:Myo7a UTSW 7 98051626 splice site probably null
R7472:Myo7a UTSW 7 98064793 missense probably damaging 1.00
R7483:Myo7a UTSW 7 98063674 missense probably benign 0.07
R7526:Myo7a UTSW 7 98085448 missense possibly damaging 0.49
R7948:Myo7a UTSW 7 98075029 missense probably damaging 1.00
R8069:Myo7a UTSW 7 98083626 nonsense probably null
R8115:Myo7a UTSW 7 98066446 missense probably damaging 0.98
R8150:Myo7a UTSW 7 98063639 missense probably benign 0.19
R8265:Myo7a UTSW 7 98085397 missense probably benign 0.00
R8289:Myo7a UTSW 7 98077169 missense probably benign
R8298:Myo7a UTSW 7 98098334 missense probably damaging 1.00
R8518:Myo7a UTSW 7 98091063 missense possibly damaging 0.58
R8539:Myo7a UTSW 7 98072461 missense probably damaging 0.99
R8557:Myo7a UTSW 7 98053874 missense probably benign 0.08
R8685:Myo7a UTSW 7 98097127 missense probably benign 0.03
RF005:Myo7a UTSW 7 98093617 missense probably benign 0.42
U15987:Myo7a UTSW 7 98065790 nonsense probably null
X0028:Myo7a UTSW 7 98065725 missense probably damaging 1.00
X0058:Myo7a UTSW 7 98062648 missense probably benign 0.02
Z1176:Myo7a UTSW 7 98095727 missense probably damaging 0.98
Z1177:Myo7a UTSW 7 98052226 missense probably damaging 0.98
Z1177:Myo7a UTSW 7 98085523 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGGGCTCTTGACAGGTTGAC -3'
(R):5'- GACAATGTTTTCTGGCTGCC -3'

Sequencing Primer
(F):5'- AGGTTGACCCTGGGCCC -3'
(R):5'- CTGGCTGCCTTGGACACTTG -3'
Posted On2018-05-21