Incidental Mutation 'R6465:Pwwp2b'
ID517776
Institutional Source Beutler Lab
Gene Symbol Pwwp2b
Ensembl Gene ENSMUSG00000060260
Gene NamePWWP domain containing 2B
SynonymsD930023J19Rik, Pwwp2, D7Ertd517e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R6465 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location139248482-139269903 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 139256035 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 464 (V464A)
Ref Sequence ENSEMBL: ENSMUSP00000130888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093993] [ENSMUST00000172136]
Predicted Effect probably benign
Transcript: ENSMUST00000093993
AA Change: V464A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000091529
Gene: ENSMUSG00000060260
AA Change: V464A

DomainStartEndE-ValueType
low complexity region 105 120 N/A INTRINSIC
low complexity region 145 165 N/A INTRINSIC
low complexity region 234 245 N/A INTRINSIC
low complexity region 305 319 N/A INTRINSIC
low complexity region 381 401 N/A INTRINSIC
low complexity region 457 468 N/A INTRINSIC
PDB:4LD6|A 485 506 4e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000172136
AA Change: V464A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000130888
Gene: ENSMUSG00000060260
AA Change: V464A

DomainStartEndE-ValueType
low complexity region 105 120 N/A INTRINSIC
low complexity region 145 165 N/A INTRINSIC
low complexity region 234 245 N/A INTRINSIC
low complexity region 305 319 N/A INTRINSIC
low complexity region 381 401 N/A INTRINSIC
low complexity region 457 468 N/A INTRINSIC
Pfam:PWWP 498 583 5.5e-19 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 95% (40/42)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230113P08Rik A T 9: 35,908,625 N25Y possibly damaging Het
A2ml1 G A 6: 128,541,078 T1415I probably damaging Het
Acvr2b T A 9: 119,433,303 W461R probably damaging Het
Adam23 G T 1: 63,566,668 C637F probably damaging Het
Apol8 T G 15: 77,749,948 T143P probably benign Het
Asna1 A T 8: 85,018,565 M291K probably benign Het
Bfsp1 A C 2: 143,858,055 probably null Het
Cytl1 T C 5: 37,737,670 V99A probably benign Het
Dock2 A T 11: 34,503,413 V793E probably damaging Het
Fxyd5 G T 7: 31,037,880 T81K probably damaging Het
Gcm1 A G 9: 78,064,869 Y364C probably damaging Het
Gm37596 A G 3: 93,692,996 I22T probably damaging Het
Gm9992 G T 17: 7,374,443 T202K probably damaging Het
Haghl T C 17: 25,783,819 N190S possibly damaging Het
Inpp5j C A 11: 3,502,293 R319L possibly damaging Het
Ints10 A G 8: 68,807,536 N304S probably benign Het
Isoc1 T A 18: 58,671,256 C119S probably damaging Het
Klhl18 A G 9: 110,428,920 M414T probably benign Het
Krtap2-4 A G 11: 99,614,759 probably benign Het
Krtap3-1 G A 11: 99,566,451 P45S possibly damaging Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Myo7a A G 7: 98,062,680 V1754A possibly damaging Het
Nedd4l T A 18: 65,155,264 D119E probably benign Het
Nsun7 T C 5: 66,295,586 V548A probably benign Het
Olfr1024 A T 2: 85,904,539 S172T probably benign Het
Olfr711 A T 7: 106,972,212 V44E possibly damaging Het
Parvg A G 15: 84,328,940 D127G probably damaging Het
Piezo2 T A 18: 63,041,663 M2007L possibly damaging Het
Pou2f3 A C 9: 43,139,867 F175V probably damaging Het
Ptprn2 T C 12: 117,269,589 I958T probably damaging Het
Pzp A G 6: 128,491,619 Y982H probably damaging Het
Rad17 T A 13: 100,637,080 N202I probably benign Het
Rtel1 T A 2: 181,335,940 D271E possibly damaging Het
Sos2 T C 12: 69,596,775 S943G probably benign Het
Tm9sf2 A G 14: 122,141,207 H241R probably benign Het
Ttc8 A G 12: 98,964,570 E291G probably damaging Het
Wfikkn1 A G 17: 25,878,718 C211R probably damaging Het
Ylpm1 T A 12: 85,049,802 D1219E probably damaging Het
Zc3hav1 T C 6: 38,331,849 Y586C possibly damaging Het
Zcchc4 T A 5: 52,819,276 F471I probably benign Het
Zfp719 C A 7: 43,590,684 Y565* probably null Het
Other mutations in Pwwp2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Pwwp2b APN 7 139254855 nonsense probably null
IGL02209:Pwwp2b APN 7 139255105 missense probably damaging 1.00
IGL02938:Pwwp2b APN 7 139256143 missense probably damaging 1.00
Conservative UTSW 7 139255586 missense probably benign 0.09
Edgy UTSW 7 139256062 missense possibly damaging 0.90
R0033:Pwwp2b UTSW 7 139254928 missense possibly damaging 0.87
R0033:Pwwp2b UTSW 7 139254928 missense possibly damaging 0.87
R1491:Pwwp2b UTSW 7 139255963 missense probably damaging 1.00
R1636:Pwwp2b UTSW 7 139254842 missense probably benign 0.00
R1672:Pwwp2b UTSW 7 139254831 missense probably benign
R1793:Pwwp2b UTSW 7 139256365 missense probably damaging 0.97
R2016:Pwwp2b UTSW 7 139256151 missense possibly damaging 0.91
R2159:Pwwp2b UTSW 7 139254928 missense possibly damaging 0.87
R2228:Pwwp2b UTSW 7 139255188 missense probably damaging 1.00
R2229:Pwwp2b UTSW 7 139255188 missense probably damaging 1.00
R2380:Pwwp2b UTSW 7 139255450 missense probably damaging 1.00
R3023:Pwwp2b UTSW 7 139256194 missense probably damaging 1.00
R3933:Pwwp2b UTSW 7 139256034 missense possibly damaging 0.66
R4440:Pwwp2b UTSW 7 139255639 missense probably benign 0.09
R4844:Pwwp2b UTSW 7 139255586 missense probably benign 0.09
R4873:Pwwp2b UTSW 7 139256062 missense possibly damaging 0.90
R4875:Pwwp2b UTSW 7 139256062 missense possibly damaging 0.90
R5022:Pwwp2b UTSW 7 139255578 missense possibly damaging 0.81
R5446:Pwwp2b UTSW 7 139255150 missense probably damaging 0.96
R5656:Pwwp2b UTSW 7 139255971 missense possibly damaging 0.93
R6578:Pwwp2b UTSW 7 139256112 missense probably damaging 1.00
R6774:Pwwp2b UTSW 7 139255987 missense probably benign 0.13
R7218:Pwwp2b UTSW 7 139256133 missense probably damaging 1.00
R7316:Pwwp2b UTSW 7 139256224 missense probably benign 0.29
R7818:Pwwp2b UTSW 7 139255324 missense probably benign
R8249:Pwwp2b UTSW 7 139254843 missense probably damaging 0.99
R8319:Pwwp2b UTSW 7 139255183 missense probably damaging 0.99
R8671:Pwwp2b UTSW 7 139256410 missense probably damaging 1.00
R8785:Pwwp2b UTSW 7 139256170 missense possibly damaging 0.85
X0017:Pwwp2b UTSW 7 139255806 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTCCCCAAGGTAAACATGGCC -3'
(R):5'- TTCGCTTCTTGCCAAGAGGG -3'

Sequencing Primer
(F):5'- CCAAGGTAAACATGGCCGTGATG -3'
(R):5'- TCTGGCCAAGGCTGATGTCAAG -3'
Posted On2018-05-21