Incidental Mutation 'R6465:Asna1'
ID517778
Institutional Source Beutler Lab
Gene Symbol Asna1
Ensembl Gene ENSMUSG00000052456
Gene NamearsA arsenite transporter, ATP-binding, homolog 1 (bacterial)
SynonymsArsA, 1810048H22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6465 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location85017931-85025281 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85018565 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 291 (M291K)
Ref Sequence ENSEMBL: ENSMUSP00000065337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059072] [ENSMUST00000064314] [ENSMUST00000209322] [ENSMUST00000209421]
Predicted Effect probably benign
Transcript: ENSMUST00000059072
SMART Domains Protein: ENSMUSP00000053408
Gene: ENSMUSG00000052819

DomainStartEndE-ValueType
Pfam:Bestrophin 8 316 5.8e-118 PFAM
low complexity region 340 352 N/A INTRINSIC
low complexity region 408 417 N/A INTRINSIC
low complexity region 428 447 N/A INTRINSIC
low complexity region 457 479 N/A INTRINSIC
low complexity region 484 501 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064314
AA Change: M291K

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000065337
Gene: ENSMUSG00000052456
AA Change: M291K

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:ArsA_ATPase 37 340 2.2e-127 PFAM
Pfam:CbiA 39 311 5.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209322
Predicted Effect probably benign
Transcript: ENSMUST00000209421
Predicted Effect probably benign
Transcript: ENSMUST00000209834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211702
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents the human homolog of the bacterial arsA gene, encoding the arsenite-stimulated ATPase component of the arsenite transporter responsible for resistance to arsenicals. This protein is also a central component of a transmembrane domain (TMD) recognition complex (TRC) that is involved in the post-translational delivery of tail-anchored (TA) proteins from the cytosol to the endoplasmic reticulum (ER). It recognizes and selectively binds the TMD of TA proteins in the cytosol, and delivers them to the ER for insertion. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a null mutation display early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230113P08Rik A T 9: 35,908,625 N25Y possibly damaging Het
A2ml1 G A 6: 128,541,078 T1415I probably damaging Het
Acvr2b T A 9: 119,433,303 W461R probably damaging Het
Adam23 G T 1: 63,566,668 C637F probably damaging Het
Apol8 T G 15: 77,749,948 T143P probably benign Het
Bfsp1 A C 2: 143,858,055 probably null Het
Cytl1 T C 5: 37,737,670 V99A probably benign Het
Dock2 A T 11: 34,503,413 V793E probably damaging Het
Fxyd5 G T 7: 31,037,880 T81K probably damaging Het
Gcm1 A G 9: 78,064,869 Y364C probably damaging Het
Gm37596 A G 3: 93,692,996 I22T probably damaging Het
Gm9992 G T 17: 7,374,443 T202K probably damaging Het
Haghl T C 17: 25,783,819 N190S possibly damaging Het
Inpp5j C A 11: 3,502,293 R319L possibly damaging Het
Ints10 A G 8: 68,807,536 N304S probably benign Het
Isoc1 T A 18: 58,671,256 C119S probably damaging Het
Klhl18 A G 9: 110,428,920 M414T probably benign Het
Krtap2-4 A G 11: 99,614,759 probably benign Het
Krtap3-1 G A 11: 99,566,451 P45S possibly damaging Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Myo7a A G 7: 98,062,680 V1754A possibly damaging Het
Nedd4l T A 18: 65,155,264 D119E probably benign Het
Nsun7 T C 5: 66,295,586 V548A probably benign Het
Olfr1024 A T 2: 85,904,539 S172T probably benign Het
Olfr711 A T 7: 106,972,212 V44E possibly damaging Het
Parvg A G 15: 84,328,940 D127G probably damaging Het
Piezo2 T A 18: 63,041,663 M2007L possibly damaging Het
Pou2f3 A C 9: 43,139,867 F175V probably damaging Het
Ptprn2 T C 12: 117,269,589 I958T probably damaging Het
Pwwp2b T C 7: 139,256,035 V464A probably benign Het
Pzp A G 6: 128,491,619 Y982H probably damaging Het
Rad17 T A 13: 100,637,080 N202I probably benign Het
Rtel1 T A 2: 181,335,940 D271E possibly damaging Het
Sos2 T C 12: 69,596,775 S943G probably benign Het
Tm9sf2 A G 14: 122,141,207 H241R probably benign Het
Ttc8 A G 12: 98,964,570 E291G probably damaging Het
Wfikkn1 A G 17: 25,878,718 C211R probably damaging Het
Ylpm1 T A 12: 85,049,802 D1219E probably damaging Het
Zc3hav1 T C 6: 38,331,849 Y586C possibly damaging Het
Zcchc4 T A 5: 52,819,276 F471I probably benign Het
Zfp719 C A 7: 43,590,684 Y565* probably null Het
Other mutations in Asna1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01992:Asna1 APN 8 85018556 missense possibly damaging 0.64
R0012:Asna1 UTSW 8 85025096 splice site probably benign
R0378:Asna1 UTSW 8 85025264 start codon destroyed probably null
R0504:Asna1 UTSW 8 85018607 missense probably damaging 1.00
R1188:Asna1 UTSW 8 85019793 missense probably damaging 1.00
R2001:Asna1 UTSW 8 85025160 missense probably damaging 0.96
R2029:Asna1 UTSW 8 85019774 nonsense probably null
R2264:Asna1 UTSW 8 85025258 unclassified probably benign
R2511:Asna1 UTSW 8 85019766 missense possibly damaging 0.79
R4676:Asna1 UTSW 8 85018873 missense probably benign 0.01
R5401:Asna1 UTSW 8 85018544 missense possibly damaging 0.56
R7378:Asna1 UTSW 8 85019863 missense probably benign 0.24
R8029:Asna1 UTSW 8 85019827 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAGTAAATCCAGGGATGGCC -3'
(R):5'- TGTCTTGTGCCCTACAGGAAC -3'

Sequencing Primer
(F):5'- GTTGAGCTCCAGTCCTCTGAATACAG -3'
(R):5'- CAGACAACGTTCATCTGTGTG -3'
Posted On2018-05-21