Incidental Mutation 'R6465:Pou2f3'
ID517780
Institutional Source Beutler Lab
Gene Symbol Pou2f3
Ensembl Gene ENSMUSG00000032015
Gene NamePOU domain, class 2, transcription factor 3
SynonymsOtf-11, Epoc-1, Oct11, Skin, Skn-li, Skn-1a, Oct-11a, Skin-1a, Otf11
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6465 (G1)
Quality Score195.009
Status Validated
Chromosome9
Chromosomal Location43123939-43210369 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 43139867 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 175 (F175V)
Ref Sequence ENSEMBL: ENSMUSP00000034513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034513] [ENSMUST00000176636]
Predicted Effect probably damaging
Transcript: ENSMUST00000034513
AA Change: F175V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034513
Gene: ENSMUSG00000032015
AA Change: F175V

DomainStartEndE-ValueType
low complexity region 107 122 N/A INTRINSIC
low complexity region 150 162 N/A INTRINSIC
POU 164 238 1.47e-53 SMART
low complexity region 239 256 N/A INTRINSIC
HOX 262 324 8.39e-20 SMART
low complexity region 337 352 N/A INTRINSIC
low complexity region 362 378 N/A INTRINSIC
low complexity region 386 408 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176636
AA Change: F187V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135115
Gene: ENSMUSG00000032015
AA Change: F187V

DomainStartEndE-ValueType
low complexity region 119 134 N/A INTRINSIC
low complexity region 162 174 N/A INTRINSIC
POU 176 250 1.47e-53 SMART
low complexity region 251 268 N/A INTRINSIC
HOX 274 336 8.39e-20 SMART
low complexity region 349 364 N/A INTRINSIC
low complexity region 374 390 N/A INTRINSIC
low complexity region 398 420 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213862
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the POU domain family of transcription factors. POU domain transcription factors bind to a specific octamer DNA motif and regulate cell type-specific differentiation pathways. The encoded protein is primarily expressed in the epidermis, and plays a critical role in keratinocyte proliferation and differentiation. The encoded protein is also a candidate tumor suppressor protein, and aberrant promoter methylation of this gene may play a role in cervical cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for one null mutation exhibit defective keratinocyte differentiation, however the skin and coat appear normal. Mice homozygous for another null mutation display loss of sweet, umami and bitter taste perception and expansion of sour taste receptor cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230113P08Rik A T 9: 35,908,625 N25Y possibly damaging Het
A2ml1 G A 6: 128,541,078 T1415I probably damaging Het
Acvr2b T A 9: 119,433,303 W461R probably damaging Het
Adam23 G T 1: 63,566,668 C637F probably damaging Het
Apol8 T G 15: 77,749,948 T143P probably benign Het
Asna1 A T 8: 85,018,565 M291K probably benign Het
Bfsp1 A C 2: 143,858,055 probably null Het
Cytl1 T C 5: 37,737,670 V99A probably benign Het
Dock2 A T 11: 34,503,413 V793E probably damaging Het
Fxyd5 G T 7: 31,037,880 T81K probably damaging Het
Gcm1 A G 9: 78,064,869 Y364C probably damaging Het
Gm37596 A G 3: 93,692,996 I22T probably damaging Het
Gm9992 G T 17: 7,374,443 T202K probably damaging Het
Haghl T C 17: 25,783,819 N190S possibly damaging Het
Inpp5j C A 11: 3,502,293 R319L possibly damaging Het
Ints10 A G 8: 68,807,536 N304S probably benign Het
Isoc1 T A 18: 58,671,256 C119S probably damaging Het
Klhl18 A G 9: 110,428,920 M414T probably benign Het
Krtap2-4 A G 11: 99,614,759 probably benign Het
Krtap3-1 G A 11: 99,566,451 P45S possibly damaging Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Myo7a A G 7: 98,062,680 V1754A possibly damaging Het
Nedd4l T A 18: 65,155,264 D119E probably benign Het
Nsun7 T C 5: 66,295,586 V548A probably benign Het
Olfr1024 A T 2: 85,904,539 S172T probably benign Het
Olfr711 A T 7: 106,972,212 V44E possibly damaging Het
Parvg A G 15: 84,328,940 D127G probably damaging Het
Piezo2 T A 18: 63,041,663 M2007L possibly damaging Het
Ptprn2 T C 12: 117,269,589 I958T probably damaging Het
Pwwp2b T C 7: 139,256,035 V464A probably benign Het
Pzp A G 6: 128,491,619 Y982H probably damaging Het
Rad17 T A 13: 100,637,080 N202I probably benign Het
Rtel1 T A 2: 181,335,940 D271E possibly damaging Het
Sos2 T C 12: 69,596,775 S943G probably benign Het
Tm9sf2 A G 14: 122,141,207 H241R probably benign Het
Ttc8 A G 12: 98,964,570 E291G probably damaging Het
Wfikkn1 A G 17: 25,878,718 C211R probably damaging Het
Ylpm1 T A 12: 85,049,802 D1219E probably damaging Het
Zc3hav1 T C 6: 38,331,849 Y586C possibly damaging Het
Zcchc4 T A 5: 52,819,276 F471I probably benign Het
Zfp719 C A 7: 43,590,684 Y565* probably null Het
Other mutations in Pou2f3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Pou2f3 APN 9 43128893 missense probably damaging 1.00
IGL00508:Pou2f3 APN 9 43139963 missense probably benign 0.01
IGL00975:Pou2f3 APN 9 43137384 missense probably benign
IGL01577:Pou2f3 APN 9 43146881 nonsense probably null
IGL01871:Pou2f3 APN 9 43134473 splice site probably benign
IGL02370:Pou2f3 APN 9 43137348 missense probably damaging 1.00
IGL02674:Pou2f3 APN 9 43139333 missense probably damaging 1.00
IGL02746:Pou2f3 APN 9 43146846 missense probably benign 0.01
IGL02956:Pou2f3 APN 9 43142805 splice site probably benign
IGL02962:Pou2f3 APN 9 43125089 utr 3 prime probably benign
IGL03082:Pou2f3 APN 9 43146915 critical splice acceptor site probably null
R0433:Pou2f3 UTSW 9 43127398 missense probably benign 0.23
R0622:Pou2f3 UTSW 9 43125119 missense probably damaging 1.00
R0926:Pou2f3 UTSW 9 43146901 missense probably damaging 1.00
R1956:Pou2f3 UTSW 9 43145237 missense probably benign
R4782:Pou2f3 UTSW 9 43139858 missense probably damaging 0.97
R4877:Pou2f3 UTSW 9 43139323 missense possibly damaging 0.58
R5070:Pou2f3 UTSW 9 43145281 missense possibly damaging 0.52
R5910:Pou2f3 UTSW 9 43134474 splice site probably null
R6280:Pou2f3 UTSW 9 43139339 missense probably damaging 1.00
R6280:Pou2f3 UTSW 9 43139340 missense probably damaging 1.00
R7084:Pou2f3 UTSW 9 43128893 missense probably damaging 1.00
R7161:Pou2f3 UTSW 9 43139363 missense probably damaging 1.00
R8036:Pou2f3 UTSW 9 43146908 missense probably damaging 1.00
R8406:Pou2f3 UTSW 9 43139858 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGGCTGGACCATGCCATTTC -3'
(R):5'- TTGTAGCTTACCATAGCGTGTG -3'

Sequencing Primer
(F):5'- TCGATCTCCCCGAGCAATG -3'
(R):5'- ACCATAGCGTGTGTTCCTTATCAGG -3'
Posted On2018-05-21