Incidental Mutation 'R6465:Ttc8'
ID517790
Institutional Source Beutler Lab
Gene Symbol Ttc8
Ensembl Gene ENSMUSG00000021013
Gene Nametetratricopeptide repeat domain 8
SynonymsBBS8, 0610012F22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.588) question?
Stock #R6465 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location98920574-98983238 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98964570 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 291 (E291G)
Ref Sequence ENSEMBL: ENSMUSP00000078148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079146] [ENSMUST00000085109] [ENSMUST00000132878]
Predicted Effect probably damaging
Transcript: ENSMUST00000079146
AA Change: E291G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078148
Gene: ENSMUSG00000021013
AA Change: E291G

DomainStartEndE-ValueType
Blast:TPR 4 37 5e-12 BLAST
TPR 225 258 2.35e-1 SMART
TPR 292 325 9.68e-3 SMART
Blast:TPR 326 359 3e-14 BLAST
TPR 360 393 2.26e-3 SMART
TPR 397 430 1.91e-1 SMART
TPR 431 464 1.81e-2 SMART
Blast:TPR 465 498 7e-14 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000085109
AA Change: E281G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000082190
Gene: ENSMUSG00000021013
AA Change: E281G

DomainStartEndE-ValueType
Blast:TPR 4 37 4e-12 BLAST
TPR 215 248 2.35e-1 SMART
TPR 282 315 9.68e-3 SMART
Blast:TPR 316 349 3e-14 BLAST
TPR 350 383 2.26e-3 SMART
TPR 387 420 1.91e-1 SMART
TPR 421 454 1.81e-2 SMART
Blast:TPR 455 488 7e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124514
Predicted Effect probably benign
Transcript: ENSMUST00000132878
SMART Domains Protein: ENSMUSP00000115828
Gene: ENSMUSG00000021013

DomainStartEndE-ValueType
SCOP:d1a17__ 128 206 2e-5 SMART
Blast:TPR 165 198 8e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223277
Meta Mutation Damage Score 0.1461 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has been directly linked to Bardet-Biedl syndrome. The primary features of this syndrome include retinal dystrophy, obesity, polydactyly, renal abnormalities and learning disabilities. Experimentation in non-human eukaryotes suggests that this gene is expressed in ciliated cells and that it is involved in the formation of cilia. A mutation in this gene has also been implicated in nonsyndromic retinitis pigmentosa. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a null mutation display partial postnatal lethality with slow postnatal weight gain, age related obesity, impaired olfation, loss of cilia from the olfactory epithelium, impaired targeting of olfactory sensory neuron axons, retinal degeneration, and mild renal tubule dilation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230113P08Rik A T 9: 35,908,625 N25Y possibly damaging Het
A2ml1 G A 6: 128,541,078 T1415I probably damaging Het
Acvr2b T A 9: 119,433,303 W461R probably damaging Het
Adam23 G T 1: 63,566,668 C637F probably damaging Het
Apol8 T G 15: 77,749,948 T143P probably benign Het
Asna1 A T 8: 85,018,565 M291K probably benign Het
Bfsp1 A C 2: 143,858,055 probably null Het
Cytl1 T C 5: 37,737,670 V99A probably benign Het
Dock2 A T 11: 34,503,413 V793E probably damaging Het
Fxyd5 G T 7: 31,037,880 T81K probably damaging Het
Gcm1 A G 9: 78,064,869 Y364C probably damaging Het
Gm37596 A G 3: 93,692,996 I22T probably damaging Het
Gm9992 G T 17: 7,374,443 T202K probably damaging Het
Haghl T C 17: 25,783,819 N190S possibly damaging Het
Inpp5j C A 11: 3,502,293 R319L possibly damaging Het
Ints10 A G 8: 68,807,536 N304S probably benign Het
Isoc1 T A 18: 58,671,256 C119S probably damaging Het
Klhl18 A G 9: 110,428,920 M414T probably benign Het
Krtap2-4 A G 11: 99,614,759 probably benign Het
Krtap3-1 G A 11: 99,566,451 P45S possibly damaging Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Myo7a A G 7: 98,062,680 V1754A possibly damaging Het
Nedd4l T A 18: 65,155,264 D119E probably benign Het
Nsun7 T C 5: 66,295,586 V548A probably benign Het
Olfr1024 A T 2: 85,904,539 S172T probably benign Het
Olfr711 A T 7: 106,972,212 V44E possibly damaging Het
Parvg A G 15: 84,328,940 D127G probably damaging Het
Piezo2 T A 18: 63,041,663 M2007L possibly damaging Het
Pou2f3 A C 9: 43,139,867 F175V probably damaging Het
Ptprn2 T C 12: 117,269,589 I958T probably damaging Het
Pwwp2b T C 7: 139,256,035 V464A probably benign Het
Pzp A G 6: 128,491,619 Y982H probably damaging Het
Rad17 T A 13: 100,637,080 N202I probably benign Het
Rtel1 T A 2: 181,335,940 D271E possibly damaging Het
Sos2 T C 12: 69,596,775 S943G probably benign Het
Tm9sf2 A G 14: 122,141,207 H241R probably benign Het
Wfikkn1 A G 17: 25,878,718 C211R probably damaging Het
Ylpm1 T A 12: 85,049,802 D1219E probably damaging Het
Zc3hav1 T C 6: 38,331,849 Y586C possibly damaging Het
Zcchc4 T A 5: 52,819,276 F471I probably benign Het
Zfp719 C A 7: 43,590,684 Y565* probably null Het
Other mutations in Ttc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Ttc8 APN 12 98976018 missense probably damaging 0.96
IGL01139:Ttc8 APN 12 98964545 nonsense probably null
IGL02179:Ttc8 APN 12 98964537 missense possibly damaging 0.87
IGL02715:Ttc8 APN 12 98943920 splice site probably benign
IGL02958:Ttc8 APN 12 98964544 missense probably benign 0.03
IGL03249:Ttc8 APN 12 98943821 splice site probably benign
P0035:Ttc8 UTSW 12 98976416 splice site probably benign
R0606:Ttc8 UTSW 12 98943459 splice site probably benign
R1005:Ttc8 UTSW 12 98937144 missense probably benign 0.11
R1584:Ttc8 UTSW 12 98920764 missense probably benign 0.01
R1628:Ttc8 UTSW 12 98982521 missense probably benign 0.07
R1706:Ttc8 UTSW 12 98943883 missense probably benign 0.02
R4585:Ttc8 UTSW 12 98982530 missense probably benign
R4720:Ttc8 UTSW 12 98979809 missense possibly damaging 0.94
R4879:Ttc8 UTSW 12 98942303 missense possibly damaging 0.55
R5110:Ttc8 UTSW 12 98942303 missense probably benign 0.25
R6272:Ttc8 UTSW 12 98982494 missense possibly damaging 0.63
R6620:Ttc8 UTSW 12 98957320 missense possibly damaging 0.95
R6708:Ttc8 UTSW 12 98943532 missense probably damaging 0.99
R6772:Ttc8 UTSW 12 98943589 missense probably damaging 1.00
R6901:Ttc8 UTSW 12 98961476 missense probably damaging 1.00
R7060:Ttc8 UTSW 12 98943467 missense probably benign
R7117:Ttc8 UTSW 12 98976502 missense possibly damaging 0.63
R7174:Ttc8 UTSW 12 98974701 missense possibly damaging 0.79
R7385:Ttc8 UTSW 12 98942288 missense possibly damaging 0.78
R7447:Ttc8 UTSW 12 98943872 missense probably damaging 0.97
R7589:Ttc8 UTSW 12 98976437 missense probably damaging 1.00
R8517:Ttc8 UTSW 12 98943335 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTGTGACAATAATAACCCCACAG -3'
(R):5'- CTGAACCATGGCCAACGATC -3'

Sequencing Primer
(F):5'- GGAAAACTCTTACTGTAATTTCTGGG -3'
(R):5'- AACTGTGCTCCCTACTAG -3'
Posted On2018-05-21