Mutagenetix > Incidental Mutation

Incidental Mutation 'R6465:Ptprn2'

517791

Institutional Source

Beutler Lab

Gene Symbol

Ptprn2

Ensembl Gene

ENSMUSG00000056553

Gene Name

protein tyrosine phosphatase, receptor type, N polypeptide 2

Synonyms

phogrin, 4930425H11Rik, IA-2 beta, PTP-NP, IA-2beta

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.168) question?

Stock #

R6465 (G1)

Quality Score

210.009

Status

Validated

Chromosome

Chromosomal Location

116485720-117276849 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 117269589 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 958 (I958T)

Ref Sequence

ENSEMBL: ENSMUSP00000064046 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070733] [ENSMUST00000190247]

AlphaFold

P80560

Predicted Effect

probably damaging
Transcript: ENSMUST00000070733
AA Change: I958T

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000064046
Gene: ENSMUSG00000056553
AA Change: I958T

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
RESP18	58	157	1.9e-40	SMART
low complexity region	393	426	N/A	INTRINSIC
Pfam:Receptor_IA-2	495	583	1.5e-35	PFAM
low complexity region	687	707	N/A	INTRINSIC
PTPc	730	993	4.42e-119	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190132

Predicted Effect

probably benign
Transcript: ENSMUST00000190247

SMART Domains

Protein: ENSMUSP00000139978
Gene: ENSMUSG00000056553

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
RESP18	58	157	1.9e-40	SMART
low complexity region	393	426	N/A	INTRINSIC
Pfam:Receptor_IA-2	494	584	2.5e-43	PFAM
transmembrane domain	602	624	N/A	INTRINSIC
low complexity region	687	707	N/A	INTRINSIC
PTPc	730	932	8.81e-64	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.8%
20x: 93.1%

Validation Efficiency

95% (40/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to receptor-like protein tyrosine phosphatases. However, tyrosine phosphatase activity has not been experimentally validated for this protein. Studies of the rat ortholog suggest that the encoded protein may instead function as a phosphatidylinositol phosphatase with the ability to dephosphorylate phosphatidylinositol 3-phosphate and phosphatidylinositol 4,5-diphosphate, and this function may be involved in the regulation of insulin secretion. This protein has been identified as an autoantigen in insulin-dependent diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Homozygous null mice display impaired glucose tolerance but normal fasting and non-fasting blood glucose and insulin levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230113P08Rik	A	T	9: 35,908,625	N25Y	possibly damaging	Het
A2ml1	G	A	6: 128,541,078	T1415I	probably damaging	Het
Acvr2b	T	A	9: 119,433,303	W461R	probably damaging	Het
Adam23	G	T	1: 63,566,668	C637F	probably damaging	Het
Apol8	T	G	15: 77,749,948	T143P	probably benign	Het
Asna1	A	T	8: 85,018,565	M291K	probably benign	Het
Bfsp1	A	C	2: 143,858,055		probably null	Het
Cytl1	T	C	5: 37,737,670	V99A	probably benign	Het
Dock2	A	T	11: 34,503,413	V793E	probably damaging	Het
Fxyd5	G	T	7: 31,037,880	T81K	probably damaging	Het
Gcm1	A	G	9: 78,064,869	Y364C	probably damaging	Het
Gm37596	A	G	3: 93,692,996	I22T	probably damaging	Het
Gm9992	G	T	17: 7,374,443	T202K	probably damaging	Het
Haghl	T	C	17: 25,783,819	N190S	possibly damaging	Het
Inpp5j	C	A	11: 3,502,293	R319L	possibly damaging	Het
Ints10	A	G	8: 68,807,536	N304S	probably benign	Het
Isoc1	T	A	18: 58,671,256	C119S	probably damaging	Het
Klhl18	A	G	9: 110,428,920	M414T	probably benign	Het
Krtap2-4	A	G	11: 99,614,759		probably benign	Het
Krtap3-1	G	A	11: 99,566,451	P45S	possibly damaging	Het
Mroh2a	GCCC	GC	1: 88,232,257		probably null	Het
Myo7a	A	G	7: 98,062,680	V1754A	possibly damaging	Het
Nedd4l	T	A	18: 65,155,264	D119E	probably benign	Het
Nsun7	T	C	5: 66,295,586	V548A	probably benign	Het
Olfr1024	A	T	2: 85,904,539	S172T	probably benign	Het
Olfr711	A	T	7: 106,972,212	V44E	possibly damaging	Het
Parvg	A	G	15: 84,328,940	D127G	probably damaging	Het
Piezo2	T	A	18: 63,041,663	M2007L	possibly damaging	Het
Pou2f3	A	C	9: 43,139,867	F175V	probably damaging	Het
Pwwp2b	T	C	7: 139,256,035	V464A	probably benign	Het
Pzp	A	G	6: 128,491,619	Y982H	probably damaging	Het
Rad17	T	A	13: 100,637,080	N202I	probably benign	Het
Rtel1	T	A	2: 181,335,940	D271E	possibly damaging	Het
Sos2	T	C	12: 69,596,775	S943G	probably benign	Het
Tm9sf2	A	G	14: 122,141,207	H241R	probably benign	Het
Ttc8	A	G	12: 98,964,570	E291G	probably damaging	Het
Wfikkn1	A	G	17: 25,878,718	C211R	probably damaging	Het
Ylpm1	T	A	12: 85,049,802	D1219E	probably damaging	Het
Zc3hav1	T	C	6: 38,331,849	Y586C	possibly damaging	Het
Zcchc4	T	A	5: 52,819,276	F471I	probably benign	Het
Zfp719	C	A	7: 43,590,684	Y565*	probably null	Het

Other mutations in Ptprn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01695:Ptprn2	APN	12	116841388	missense	probably benign	0.02
IGL01788:Ptprn2	APN	12	116900987	missense	probably damaging	0.98
IGL02172:Ptprn2	APN	12	116873697	splice site	probably benign
IGL02339:Ptprn2	APN	12	116722104	missense	probably damaging	1.00
IGL02706:Ptprn2	APN	12	116888898	missense	probably damaging	0.96
IGL03018:Ptprn2	APN	12	117211943	missense	probably damaging	1.00
IGL03267:Ptprn2	APN	12	116876344	nonsense	probably null
BB001:Ptprn2	UTSW	12	116841264	missense	probably benign	0.00
BB011:Ptprn2	UTSW	12	116841264	missense	probably benign	0.00
IGL03014:Ptprn2	UTSW	12	117248688	missense	probably damaging	1.00
R0066:Ptprn2	UTSW	12	117276602	missense	probably benign	0.07
R0066:Ptprn2	UTSW	12	117276602	missense	probably benign	0.07
R0115:Ptprn2	UTSW	12	117211846	splice site	probably benign
R0131:Ptprn2	UTSW	12	116722091	missense	probably damaging	1.00
R0131:Ptprn2	UTSW	12	116722091	missense	probably damaging	1.00
R0132:Ptprn2	UTSW	12	116722091	missense	probably damaging	1.00
R0481:Ptprn2	UTSW	12	117211846	splice site	probably benign
R0694:Ptprn2	UTSW	12	116824355	missense	possibly damaging	0.69
R0698:Ptprn2	UTSW	12	116722130	nonsense	probably null
R0746:Ptprn2	UTSW	12	116901017	missense	probably benign	0.00
R1127:Ptprn2	UTSW	12	117212008	splice site	probably null
R1443:Ptprn2	UTSW	12	117253615	missense	probably damaging	1.00
R1508:Ptprn2	UTSW	12	117184722	missense	probably damaging	1.00
R1664:Ptprn2	UTSW	12	117161709	missense	probably damaging	0.99
R1670:Ptprn2	UTSW	12	116722172	missense	possibly damaging	0.64
R1749:Ptprn2	UTSW	12	116580428	missense	probably benign	0.00
R2075:Ptprn2	UTSW	12	117247717	missense	probably benign	0.01
R3054:Ptprn2	UTSW	12	116722133	missense	probably damaging	1.00
R3107:Ptprn2	UTSW	12	116876180	missense	probably benign	0.04
R3109:Ptprn2	UTSW	12	116876180	missense	probably benign	0.04
R3552:Ptprn2	UTSW	12	116888877	missense	probably benign	0.00
R4193:Ptprn2	UTSW	12	116901008	missense	probably benign	0.01
R4523:Ptprn2	UTSW	12	116876000	missense	probably damaging	1.00
R4706:Ptprn2	UTSW	12	116872094	missense	probably benign	0.02
R4719:Ptprn2	UTSW	12	116824396	missense	possibly damaging	0.95
R4726:Ptprn2	UTSW	12	117247773	nonsense	probably null
R4872:Ptprn2	UTSW	12	117161694	missense	probably damaging	1.00
R4891:Ptprn2	UTSW	12	117233365	splice site	probably null
R4970:Ptprn2	UTSW	12	117276595	missense	probably damaging	1.00
R5208:Ptprn2	UTSW	12	116858928	missense	probably damaging	1.00
R5287:Ptprn2	UTSW	12	117211862	missense	probably damaging	1.00
R5419:Ptprn2	UTSW	12	117184647	missense	probably damaging	0.99
R6035:Ptprn2	UTSW	12	117255595	missense	probably damaging	1.00
R6035:Ptprn2	UTSW	12	117255595	missense	probably damaging	1.00
R6180:Ptprn2	UTSW	12	116859119	missense	probably benign	0.05
R6277:Ptprn2	UTSW	12	116876180	missense	probably benign	0.04
R6488:Ptprn2	UTSW	12	116872038	missense	probably benign	0.13
R6555:Ptprn2	UTSW	12	117227200	missense	probably damaging	1.00
R6908:Ptprn2	UTSW	12	116888888	missense	probably benign	0.06
R7120:Ptprn2	UTSW	12	116872056	missense	probably benign	0.01
R7229:Ptprn2	UTSW	12	117227225	splice site	probably null
R7237:Ptprn2	UTSW	12	117161727	missense	probably benign	0.03
R7304:Ptprn2	UTSW	12	117248544	missense	probably damaging	1.00
R7355:Ptprn2	UTSW	12	116858951	missense	probably benign
R7460:Ptprn2	UTSW	12	117248681	missense	probably benign	0.05
R7577:Ptprn2	UTSW	12	116485866	start codon destroyed	probably null
R7658:Ptprn2	UTSW	12	116722119	missense	probably benign	0.01
R7666:Ptprn2	UTSW	12	116841320	missense	probably benign	0.10
R7924:Ptprn2	UTSW	12	116841264	missense	probably benign	0.00
R8219:Ptprn2	UTSW	12	117184737	missense	probably benign	0.30
R8716:Ptprn2	UTSW	12	117255548	missense	possibly damaging	0.73
R9235:Ptprn2	UTSW	12	117269651	critical splice donor site	probably null
R9605:Ptprn2	UTSW	12	117161658	missense	probably benign	0.13
X0066:Ptprn2	UTSW	12	117161760	missense	probably damaging	1.00
X0066:Ptprn2	UTSW	12	117184740	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- GCTAATGAAAGCTGCCCTGG -3'
(R):5'- GATGCTTACCCAGACCAGAG -3'

Sequencing Primer
(F):5'- TTTCTATATGAACACTGGAATTGCAG -3'
(R):5'- ACCAGAGCCATTGTGTACG -3'

Posted On

2018-05-21