Incidental Mutation 'R6465:Apol8'
ID517794
Institutional Source Beutler Lab
Gene Symbol Apol8
Ensembl Gene ENSMUSG00000056656
Gene Nameapolipoprotein L 8
SynonymsApol2, 9830006J20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6465 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location77747798-77757003 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 77749948 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 143 (T143P)
Ref Sequence ENSEMBL: ENSMUSP00000086873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070911] [ENSMUST00000089450] [ENSMUST00000229332] [ENSMUST00000229445]
Predicted Effect probably benign
Transcript: ENSMUST00000070911
AA Change: T143P

PolyPhen 2 Score 0.208 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000064237
Gene: ENSMUSG00000056656
AA Change: T143P

DomainStartEndE-ValueType
Pfam:ApoL 26 333 2.5e-131 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089450
AA Change: T143P

PolyPhen 2 Score 0.208 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000086873
Gene: ENSMUSG00000056656
AA Change: T143P

DomainStartEndE-ValueType
Pfam:ApoL 1 307 9.4e-129 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229332
Predicted Effect probably benign
Transcript: ENSMUST00000229445
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230332
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the apolipoprotein L gene family. The encoded protein is found in the cytoplasm, where it may affect the movement of lipids or allow the binding of lipids to organelles. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230113P08Rik A T 9: 35,908,625 N25Y possibly damaging Het
A2ml1 G A 6: 128,541,078 T1415I probably damaging Het
Acvr2b T A 9: 119,433,303 W461R probably damaging Het
Adam23 G T 1: 63,566,668 C637F probably damaging Het
Asna1 A T 8: 85,018,565 M291K probably benign Het
Bfsp1 A C 2: 143,858,055 probably null Het
Cytl1 T C 5: 37,737,670 V99A probably benign Het
Dock2 A T 11: 34,503,413 V793E probably damaging Het
Fxyd5 G T 7: 31,037,880 T81K probably damaging Het
Gcm1 A G 9: 78,064,869 Y364C probably damaging Het
Gm37596 A G 3: 93,692,996 I22T probably damaging Het
Gm9992 G T 17: 7,374,443 T202K probably damaging Het
Haghl T C 17: 25,783,819 N190S possibly damaging Het
Inpp5j C A 11: 3,502,293 R319L possibly damaging Het
Ints10 A G 8: 68,807,536 N304S probably benign Het
Isoc1 T A 18: 58,671,256 C119S probably damaging Het
Klhl18 A G 9: 110,428,920 M414T probably benign Het
Krtap2-4 A G 11: 99,614,759 probably benign Het
Krtap3-1 G A 11: 99,566,451 P45S possibly damaging Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Myo7a A G 7: 98,062,680 V1754A possibly damaging Het
Nedd4l T A 18: 65,155,264 D119E probably benign Het
Nsun7 T C 5: 66,295,586 V548A probably benign Het
Olfr1024 A T 2: 85,904,539 S172T probably benign Het
Olfr711 A T 7: 106,972,212 V44E possibly damaging Het
Parvg A G 15: 84,328,940 D127G probably damaging Het
Piezo2 T A 18: 63,041,663 M2007L possibly damaging Het
Pou2f3 A C 9: 43,139,867 F175V probably damaging Het
Ptprn2 T C 12: 117,269,589 I958T probably damaging Het
Pwwp2b T C 7: 139,256,035 V464A probably benign Het
Pzp A G 6: 128,491,619 Y982H probably damaging Het
Rad17 T A 13: 100,637,080 N202I probably benign Het
Rtel1 T A 2: 181,335,940 D271E possibly damaging Het
Sos2 T C 12: 69,596,775 S943G probably benign Het
Tm9sf2 A G 14: 122,141,207 H241R probably benign Het
Ttc8 A G 12: 98,964,570 E291G probably damaging Het
Wfikkn1 A G 17: 25,878,718 C211R probably damaging Het
Ylpm1 T A 12: 85,049,802 D1219E probably damaging Het
Zc3hav1 T C 6: 38,331,849 Y586C possibly damaging Het
Zcchc4 T A 5: 52,819,276 F471I probably benign Het
Zfp719 C A 7: 43,590,684 Y565* probably null Het
Other mutations in Apol8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Apol8 APN 15 77750014 missense probably damaging 1.00
IGL00569:Apol8 APN 15 77750055 missense probably benign 0.01
IGL01955:Apol8 APN 15 77749699 missense probably benign 0.01
R0677:Apol8 UTSW 15 77749851 missense probably damaging 1.00
R0964:Apol8 UTSW 15 77749611 missense probably benign 0.43
R1720:Apol8 UTSW 15 77749366 missense possibly damaging 0.93
R3508:Apol8 UTSW 15 77749443 missense probably damaging 0.97
R6771:Apol8 UTSW 15 77753058 splice site probably null
R7819:Apol8 UTSW 15 77749759 missense probably damaging 1.00
R8113:Apol8 UTSW 15 77750136 missense probably benign 0.00
R8511:Apol8 UTSW 15 77750073 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTGAATGAACCACAGCGTC -3'
(R):5'- AAAGGCTCCAACGTGACCTG -3'

Sequencing Primer
(F):5'- AGCGTCTGCAACCATCTTCAC -3'
(R):5'- TCCAACGTGACCTGCAGGAC -3'
Posted On2018-05-21