Incidental Mutation 'R6465:Gm9992'
ID517796
Institutional Source Beutler Lab
Gene Symbol Gm9992
Ensembl Gene ENSMUSG00000056133
Gene Namepredicted gene 9992
SynonymsUnc93a
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R6465 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location7362815-7385464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 7374443 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 202 (T202K)
Ref Sequence ENSEMBL: ENSMUSP00000064469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070059] [ENSMUST00000231397] [ENSMUST00000231922]
Predicted Effect probably damaging
Transcript: ENSMUST00000070059
AA Change: T202K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064469
Gene: ENSMUSG00000056133
AA Change: T202K

DomainStartEndE-ValueType
Pfam:UNC-93 11 168 2.7e-16 PFAM
transmembrane domain 199 221 N/A INTRINSIC
low complexity region 235 241 N/A INTRINSIC
transmembrane domain 258 275 N/A INTRINSIC
transmembrane domain 290 312 N/A INTRINSIC
transmembrane domain 319 341 N/A INTRINSIC
transmembrane domain 394 416 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178099
Predicted Effect probably benign
Transcript: ENSMUST00000231397
Predicted Effect probably benign
Transcript: ENSMUST00000231922
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 95% (40/42)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230113P08Rik A T 9: 35,908,625 N25Y possibly damaging Het
A2ml1 G A 6: 128,541,078 T1415I probably damaging Het
Acvr2b T A 9: 119,433,303 W461R probably damaging Het
Adam23 G T 1: 63,566,668 C637F probably damaging Het
Apol8 T G 15: 77,749,948 T143P probably benign Het
Asna1 A T 8: 85,018,565 M291K probably benign Het
Bfsp1 A C 2: 143,858,055 probably null Het
Cytl1 T C 5: 37,737,670 V99A probably benign Het
Dock2 A T 11: 34,503,413 V793E probably damaging Het
Fxyd5 G T 7: 31,037,880 T81K probably damaging Het
Gcm1 A G 9: 78,064,869 Y364C probably damaging Het
Gm37596 A G 3: 93,692,996 I22T probably damaging Het
Haghl T C 17: 25,783,819 N190S possibly damaging Het
Inpp5j C A 11: 3,502,293 R319L possibly damaging Het
Ints10 A G 8: 68,807,536 N304S probably benign Het
Isoc1 T A 18: 58,671,256 C119S probably damaging Het
Klhl18 A G 9: 110,428,920 M414T probably benign Het
Krtap2-4 A G 11: 99,614,759 probably benign Het
Krtap3-1 G A 11: 99,566,451 P45S possibly damaging Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Myo7a A G 7: 98,062,680 V1754A possibly damaging Het
Nedd4l T A 18: 65,155,264 D119E probably benign Het
Nsun7 T C 5: 66,295,586 V548A probably benign Het
Olfr1024 A T 2: 85,904,539 S172T probably benign Het
Olfr711 A T 7: 106,972,212 V44E possibly damaging Het
Parvg A G 15: 84,328,940 D127G probably damaging Het
Piezo2 T A 18: 63,041,663 M2007L possibly damaging Het
Pou2f3 A C 9: 43,139,867 F175V probably damaging Het
Ptprn2 T C 12: 117,269,589 I958T probably damaging Het
Pwwp2b T C 7: 139,256,035 V464A probably benign Het
Pzp A G 6: 128,491,619 Y982H probably damaging Het
Rad17 T A 13: 100,637,080 N202I probably benign Het
Rtel1 T A 2: 181,335,940 D271E possibly damaging Het
Sos2 T C 12: 69,596,775 S943G probably benign Het
Tm9sf2 A G 14: 122,141,207 H241R probably benign Het
Ttc8 A G 12: 98,964,570 E291G probably damaging Het
Wfikkn1 A G 17: 25,878,718 C211R probably damaging Het
Ylpm1 T A 12: 85,049,802 D1219E probably damaging Het
Zc3hav1 T C 6: 38,331,849 Y586C possibly damaging Het
Zcchc4 T A 5: 52,819,276 F471I probably benign Het
Zfp719 C A 7: 43,590,684 Y565* probably null Het
Other mutations in Gm9992
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Gm9992 APN 17 7369739 missense probably damaging 1.00
IGL01609:Gm9992 APN 17 7369739 missense probably damaging 0.96
R0893:Gm9992 UTSW 17 7374527 missense probably damaging 0.98
R5271:Gm9992 UTSW 17 7369682 missense possibly damaging 0.82
R5326:Gm9992 UTSW 17 7369788 missense probably benign 0.35
R5542:Gm9992 UTSW 17 7369788 missense probably benign 0.35
R5567:Gm9992 UTSW 17 7363803 missense probably benign 0.04
R5750:Gm9992 UTSW 17 7369731 missense probably benign 0.11
R6714:Gm9992 UTSW 17 7376538 missense probably benign 0.05
R7130:Gm9992 UTSW 17 7370425 missense probably benign 0.16
R7142:Gm9992 UTSW 17 7376622 missense probably damaging 0.97
R7222:Gm9992 UTSW 17 7376467 missense probably damaging 1.00
Z1176:Gm9992 UTSW 17 7376530 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTAGTCCTATAACTGGTAGGGC -3'
(R):5'- CATACTTTGACCGCTGACTTCG -3'

Sequencing Primer
(F):5'- CTGCACGTTTGGGAAAAATCAC -3'
(R):5'- GCTGACTTCGGCCTTAGGTC -3'
Posted On2018-05-21