Incidental Mutation 'R6465:Wfikkn1'
ID517798
Institutional Source Beutler Lab
Gene Symbol Wfikkn1
Ensembl Gene ENSMUSG00000071192
Gene NameWAP, FS, Ig, KU, and NTR-containing protein 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R6465 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location25877630-25880305 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25878718 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 211 (C211R)
Ref Sequence ENSEMBL: ENSMUSP00000093141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026826] [ENSMUST00000026827] [ENSMUST00000095487] [ENSMUST00000110456] [ENSMUST00000163356] [ENSMUST00000164982] [ENSMUST00000166146] [ENSMUST00000167018] [ENSMUST00000167626] [ENSMUST00000169085] [ENSMUST00000169308] [ENSMUST00000176696] [ENSMUST00000179998]
Predicted Effect probably benign
Transcript: ENSMUST00000026826
SMART Domains Protein: ENSMUSP00000026826
Gene: ENSMUSG00000025730

DomainStartEndE-ValueType
RAB 15 177 9.2e-77 SMART
SOCS 183 226 1.6e-18 SMART
SOCS_box 189 225 7.2e-10 SMART
low complexity region 238 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000026827
SMART Domains Protein: ENSMUSP00000026827
Gene: ENSMUSG00000025731

DomainStartEndE-ValueType
Pfam:DUF938 1 203 7.4e-95 PFAM
Pfam:Methyltransf_25 31 133 1.1e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000095487
AA Change: C211R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093141
Gene: ENSMUSG00000071192
AA Change: C211R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
WAP 32 82 4.04e-3 SMART
KAZAL 119 161 1.96e-2 SMART
IGc2 202 274 2.54e-14 SMART
KU 301 356 4.2e-3 SMART
KU 361 414 1.82e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110456
SMART Domains Protein: ENSMUSP00000106086
Gene: ENSMUSG00000025731

DomainStartEndE-ValueType
Pfam:DUF938 1 78 8.6e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163356
SMART Domains Protein: ENSMUSP00000130209
Gene: ENSMUSG00000025731

DomainStartEndE-ValueType
Pfam:DUF938 1 172 1.6e-74 PFAM
Pfam:Methyltransf_25 31 133 9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164982
SMART Domains Protein: ENSMUSP00000127868
Gene: ENSMUSG00000025730

DomainStartEndE-ValueType
RAB 15 158 5.56e-54 SMART
SOCS 164 207 2.56e-16 SMART
SOCS_box 170 206 9.29e-6 SMART
low complexity region 219 243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166146
SMART Domains Protein: ENSMUSP00000132355
Gene: ENSMUSG00000025730

DomainStartEndE-ValueType
SCOP:d3raba_ 10 43 3e-9 SMART
Blast:RAB 15 49 1e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166619
Predicted Effect probably benign
Transcript: ENSMUST00000167018
SMART Domains Protein: ENSMUSP00000131055
Gene: ENSMUSG00000025730

DomainStartEndE-ValueType
RAB 15 177 1.88e-74 SMART
SOCS 183 226 2.56e-16 SMART
SOCS_box 189 225 9.29e-6 SMART
low complexity region 238 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167626
SMART Domains Protein: ENSMUSP00000127546
Gene: ENSMUSG00000025730

DomainStartEndE-ValueType
RAB 15 177 9.2e-77 SMART
SOCS 183 226 1.6e-18 SMART
SOCS_box 189 225 7.2e-10 SMART
low complexity region 238 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169085
SMART Domains Protein: ENSMUSP00000125990
Gene: ENSMUSG00000025731

DomainStartEndE-ValueType
Pfam:DUF938 1 65 6.5e-29 PFAM
Pfam:DUF938 64 106 3.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169308
SMART Domains Protein: ENSMUSP00000126198
Gene: ENSMUSG00000025731

DomainStartEndE-ValueType
Pfam:DUF938 1 194 5.6e-86 PFAM
Pfam:Methyltransf_25 31 133 4.4e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176696
SMART Domains Protein: ENSMUSP00000135083
Gene: ENSMUSG00000071192

DomainStartEndE-ValueType
WAP 2 48 8.8e-2 SMART
KAZAL 85 127 1.96e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180868
Predicted Effect probably benign
Transcript: ENSMUST00000179998
SMART Domains Protein: ENSMUSP00000136612
Gene: ENSMUSG00000025730

DomainStartEndE-ValueType
RAB 15 177 9.4e-77 SMART
SOCS 183 226 1.7e-18 SMART
SOCS_box 189 225 7.3e-10 SMART
low complexity region 238 262 N/A INTRINSIC
Meta Mutation Damage Score 0.8020 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted multidomain protein consisting of a signal peptide, a WAP domain, a follistatin domain, an immunoglobulin domain, two tandem Kunitz domains, and an NTR domain. These domains have been implicated frequently in inhibition of various types of proteases, suggesting that the encoded protein may be a multivalent protease inhibitor and may control the action of multiple types of serine proteases as well as metalloproteinases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation show partial penetrance of posteriorly directed homeotic transformations throughout the axial skeleton, impaired muscle regeneration and a mild decrease in skeletal muscle weight in males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230113P08Rik A T 9: 35,908,625 N25Y possibly damaging Het
A2ml1 G A 6: 128,541,078 T1415I probably damaging Het
Acvr2b T A 9: 119,433,303 W461R probably damaging Het
Adam23 G T 1: 63,566,668 C637F probably damaging Het
Apol8 T G 15: 77,749,948 T143P probably benign Het
Asna1 A T 8: 85,018,565 M291K probably benign Het
Bfsp1 A C 2: 143,858,055 probably null Het
Cytl1 T C 5: 37,737,670 V99A probably benign Het
Dock2 A T 11: 34,503,413 V793E probably damaging Het
Fxyd5 G T 7: 31,037,880 T81K probably damaging Het
Gcm1 A G 9: 78,064,869 Y364C probably damaging Het
Gm37596 A G 3: 93,692,996 I22T probably damaging Het
Gm9992 G T 17: 7,374,443 T202K probably damaging Het
Haghl T C 17: 25,783,819 N190S possibly damaging Het
Inpp5j C A 11: 3,502,293 R319L possibly damaging Het
Ints10 A G 8: 68,807,536 N304S probably benign Het
Isoc1 T A 18: 58,671,256 C119S probably damaging Het
Klhl18 A G 9: 110,428,920 M414T probably benign Het
Krtap2-4 A G 11: 99,614,759 probably benign Het
Krtap3-1 G A 11: 99,566,451 P45S possibly damaging Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Myo7a A G 7: 98,062,680 V1754A possibly damaging Het
Nedd4l T A 18: 65,155,264 D119E probably benign Het
Nsun7 T C 5: 66,295,586 V548A probably benign Het
Olfr1024 A T 2: 85,904,539 S172T probably benign Het
Olfr711 A T 7: 106,972,212 V44E possibly damaging Het
Parvg A G 15: 84,328,940 D127G probably damaging Het
Piezo2 T A 18: 63,041,663 M2007L possibly damaging Het
Pou2f3 A C 9: 43,139,867 F175V probably damaging Het
Ptprn2 T C 12: 117,269,589 I958T probably damaging Het
Pwwp2b T C 7: 139,256,035 V464A probably benign Het
Pzp A G 6: 128,491,619 Y982H probably damaging Het
Rad17 T A 13: 100,637,080 N202I probably benign Het
Rtel1 T A 2: 181,335,940 D271E possibly damaging Het
Sos2 T C 12: 69,596,775 S943G probably benign Het
Tm9sf2 A G 14: 122,141,207 H241R probably benign Het
Ttc8 A G 12: 98,964,570 E291G probably damaging Het
Ylpm1 T A 12: 85,049,802 D1219E probably damaging Het
Zc3hav1 T C 6: 38,331,849 Y586C possibly damaging Het
Zcchc4 T A 5: 52,819,276 F471I probably benign Het
Zfp719 C A 7: 43,590,684 Y565* probably null Het
Other mutations in Wfikkn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0731:Wfikkn1 UTSW 17 25878017 missense probably damaging 0.98
R1484:Wfikkn1 UTSW 17 25877791 missense probably benign 0.01
R1545:Wfikkn1 UTSW 17 25878591 missense probably damaging 1.00
R3689:Wfikkn1 UTSW 17 25878718 missense probably damaging 1.00
R4735:Wfikkn1 UTSW 17 25878393 missense possibly damaging 0.86
R5553:Wfikkn1 UTSW 17 25878494 missense possibly damaging 0.72
R5938:Wfikkn1 UTSW 17 25878912 missense probably damaging 1.00
R7516:Wfikkn1 UTSW 17 25878046 missense probably damaging 1.00
R7566:Wfikkn1 UTSW 17 25878378 missense probably damaging 1.00
R8205:Wfikkn1 UTSW 17 25878097 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGCAGTGCAGGTATACAGG -3'
(R):5'- GGCCTTACCTATTACAACCGC -3'

Sequencing Primer
(F):5'- AGGTATACAGGCCCGCATC -3'
(R):5'- TATTACAACCGCTGCTACATGG -3'
Posted On2018-05-21