Incidental Mutation 'R6465:Piezo2'
ID 517800
Institutional Source Beutler Lab
Gene Symbol Piezo2
Ensembl Gene ENSMUSG00000041482
Gene Name piezo-type mechanosensitive ion channel component 2
Synonyms Fam38b, Fam38b2, 9030411M15Rik, Piezo2, 9430028L06Rik
MMRRC Submission 044598-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6465 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 63010213-63387183 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 63041663 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 2007 (M2007L)
Ref Sequence ENSEMBL: ENSMUSP00000040019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047480]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000047480
AA Change: M2007L

PolyPhen 2 Score 0.823 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000040019
Gene: ENSMUSG00000041482
AA Change: M2007L

DomainStartEndE-ValueType
transmembrane domain 13 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 267 289 N/A INTRINSIC
coiled coil region 455 482 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
transmembrane domain 539 561 N/A INTRINSIC
SCOP:d1eq1a_ 597 666 4e-3 SMART
transmembrane domain 682 704 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
internal_repeat_1 740 764 6.01e-5 PROSPERO
low complexity region 772 784 N/A INTRINSIC
transmembrane domain 791 813 N/A INTRINSIC
low complexity region 900 921 N/A INTRINSIC
transmembrane domain 949 971 N/A INTRINSIC
transmembrane domain 976 993 N/A INTRINSIC
transmembrane domain 1000 1022 N/A INTRINSIC
transmembrane domain 1069 1091 N/A INTRINSIC
transmembrane domain 1130 1152 N/A INTRINSIC
transmembrane domain 1156 1173 N/A INTRINSIC
transmembrane domain 1186 1208 N/A INTRINSIC
transmembrane domain 1234 1256 N/A INTRINSIC
transmembrane domain 1308 1327 N/A INTRINSIC
transmembrane domain 1331 1353 N/A INTRINSIC
Pfam:PIEZO 1383 1617 1.1e-105 PFAM
low complexity region 1807 1823 N/A INTRINSIC
low complexity region 1836 1860 N/A INTRINSIC
low complexity region 1863 1878 N/A INTRINSIC
transmembrane domain 1981 2003 N/A INTRINSIC
transmembrane domain 2010 2027 N/A INTRINSIC
internal_repeat_1 2036 2060 6.01e-5 PROSPERO
low complexity region 2167 2199 N/A INTRINSIC
transmembrane domain 2261 2283 N/A INTRINSIC
transmembrane domain 2303 2325 N/A INTRINSIC
transmembrane domain 2332 2354 N/A INTRINSIC
transmembrane domain 2364 2386 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 2412 2821 2.8e-161 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains more than thirty transmembrane domains and likely functions as part of mechanically-activated (MA) cation channels. These channels serve to connect mechanical forces to biological signals. The encoded protein quickly adapts MA currents in somatosensory neurons. Defects in this gene are a cause of type 5 distal arthrogryposis. Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230113P08Rik A T 9: 35,908,625 (GRCm38) N25Y possibly damaging Het
A2ml1 G A 6: 128,541,078 (GRCm38) T1415I probably damaging Het
Acvr2b T A 9: 119,433,303 (GRCm38) W461R probably damaging Het
Adam23 G T 1: 63,566,668 (GRCm38) C637F probably damaging Het
Apol8 T G 15: 77,749,948 (GRCm38) T143P probably benign Het
Asna1 A T 8: 85,018,565 (GRCm38) M291K probably benign Het
Bfsp1 A C 2: 143,858,055 (GRCm38) probably null Het
Cytl1 T C 5: 37,737,670 (GRCm38) V99A probably benign Het
Dock2 A T 11: 34,503,413 (GRCm38) V793E probably damaging Het
Fxyd5 G T 7: 31,037,880 (GRCm38) T81K probably damaging Het
Gcm1 A G 9: 78,064,869 (GRCm38) Y364C probably damaging Het
Gm37596 A G 3: 93,692,996 (GRCm38) I22T probably damaging Het
Gm9992 G T 17: 7,374,443 (GRCm38) T202K probably damaging Het
Haghl T C 17: 25,783,819 (GRCm38) N190S possibly damaging Het
Inpp5j C A 11: 3,502,293 (GRCm38) R319L possibly damaging Het
Ints10 A G 8: 68,807,536 (GRCm38) N304S probably benign Het
Isoc1 T A 18: 58,671,256 (GRCm38) C119S probably damaging Het
Klhl18 A G 9: 110,428,920 (GRCm38) M414T probably benign Het
Krtap2-4 A G 11: 99,614,759 (GRCm38) probably benign Het
Krtap3-1 G A 11: 99,566,451 (GRCm38) P45S possibly damaging Het
Mroh2a GCCC GC 1: 88,232,257 (GRCm38) probably null Het
Myo7a A G 7: 98,062,680 (GRCm38) V1754A possibly damaging Het
Nedd4l T A 18: 65,155,264 (GRCm38) D119E probably benign Het
Nsun7 T C 5: 66,295,586 (GRCm38) V548A probably benign Het
Olfr1024 A T 2: 85,904,539 (GRCm38) S172T probably benign Het
Olfr711 A T 7: 106,972,212 (GRCm38) V44E possibly damaging Het
Parvg A G 15: 84,328,940 (GRCm38) D127G probably damaging Het
Pou2f3 A C 9: 43,139,867 (GRCm38) F175V probably damaging Het
Ptprn2 T C 12: 117,269,589 (GRCm38) I958T probably damaging Het
Pwwp2b T C 7: 139,256,035 (GRCm38) V464A probably benign Het
Pzp A G 6: 128,491,619 (GRCm38) Y982H probably damaging Het
Rad17 T A 13: 100,637,080 (GRCm38) N202I probably benign Het
Rtel1 T A 2: 181,335,940 (GRCm38) D271E possibly damaging Het
Sos2 T C 12: 69,596,775 (GRCm38) S943G probably benign Het
Tm9sf2 A G 14: 122,141,207 (GRCm38) H241R probably benign Het
Ttc8 A G 12: 98,964,570 (GRCm38) E291G probably damaging Het
Wfikkn1 A G 17: 25,878,718 (GRCm38) C211R probably damaging Het
Ylpm1 T A 12: 85,049,802 (GRCm38) D1219E probably damaging Het
Zc3hav1 T C 6: 38,331,849 (GRCm38) Y586C possibly damaging Het
Zcchc4 T A 5: 52,819,276 (GRCm38) F471I probably benign Het
Zfp719 C A 7: 43,590,684 (GRCm38) Y565* probably null Het
Other mutations in Piezo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Piezo2 APN 18 63,117,699 (GRCm38) missense probably damaging 1.00
IGL01370:Piezo2 APN 18 63,022,460 (GRCm38) missense probably damaging 1.00
IGL01543:Piezo2 APN 18 63,070,030 (GRCm38) missense probably damaging 1.00
IGL01561:Piezo2 APN 18 63,124,614 (GRCm38) missense probably benign 0.03
IGL01568:Piezo2 APN 18 63,030,392 (GRCm38) missense probably benign 0.28
IGL01653:Piezo2 APN 18 63,182,833 (GRCm38) splice site probably benign
IGL01674:Piezo2 APN 18 63,027,559 (GRCm38) missense probably damaging 1.00
IGL01684:Piezo2 APN 18 63,083,170 (GRCm38) missense probably damaging 1.00
IGL01744:Piezo2 APN 18 63,042,788 (GRCm38) missense probably damaging 1.00
IGL01859:Piezo2 APN 18 63,092,844 (GRCm38) missense probably benign 0.10
IGL02183:Piezo2 APN 18 63,020,634 (GRCm38) missense probably benign 0.00
IGL02407:Piezo2 APN 18 63,146,844 (GRCm38) missense probably damaging 1.00
IGL02441:Piezo2 APN 18 63,072,862 (GRCm38) missense probably damaging 1.00
IGL02542:Piezo2 APN 18 63,032,924 (GRCm38) missense probably damaging 0.96
IGL02652:Piezo2 APN 18 63,024,475 (GRCm38) missense probably damaging 1.00
IGL02710:Piezo2 APN 18 63,074,659 (GRCm38) missense probably damaging 1.00
IGL02850:Piezo2 APN 18 63,020,633 (GRCm38) missense probably benign 0.18
IGL02851:Piezo2 APN 18 63,020,633 (GRCm38) missense probably benign 0.18
IGL02972:Piezo2 APN 18 63,064,785 (GRCm38) splice site probably benign
IGL03011:Piezo2 APN 18 63,124,660 (GRCm38) missense probably benign 0.03
IGL03078:Piezo2 APN 18 63,070,075 (GRCm38) missense probably damaging 1.00
IGL03114:Piezo2 APN 18 63,030,272 (GRCm38) splice site probably null
IGL03129:Piezo2 APN 18 63,114,972 (GRCm38) missense probably benign
IGL03143:Piezo2 APN 18 63,108,076 (GRCm38) missense probably damaging 0.99
IGL03202:Piezo2 APN 18 63,011,598 (GRCm38) missense probably damaging 1.00
IGL03227:Piezo2 APN 18 63,124,606 (GRCm38) missense probably damaging 1.00
IGL03228:Piezo2 APN 18 63,053,062 (GRCm38) missense probably damaging 1.00
IGL03230:Piezo2 APN 18 63,041,720 (GRCm38) missense probably damaging 1.00
IGL03242:Piezo2 APN 18 63,011,538 (GRCm38) utr 3 prime probably benign
IGL03291:Piezo2 APN 18 63,021,308 (GRCm38) missense probably damaging 1.00
IGL03301:Piezo2 APN 18 63,027,704 (GRCm38) missense probably damaging 1.00
Piccolo UTSW 18 63,011,696 (GRCm38) missense probably damaging 1.00
sopranino UTSW 18 63,024,466 (GRCm38) missense probably damaging 1.00
woodwind UTSW 18 63,124,642 (GRCm38) missense possibly damaging 0.50
P0023:Piezo2 UTSW 18 63,386,200 (GRCm38) splice site probably benign
PIT4802001:Piezo2 UTSW 18 63,024,469 (GRCm38) missense probably damaging 1.00
R0070:Piezo2 UTSW 18 63,102,084 (GRCm38) missense probably damaging 1.00
R0416:Piezo2 UTSW 18 63,024,491 (GRCm38) missense probably damaging 1.00
R0486:Piezo2 UTSW 18 63,029,061 (GRCm38) missense probably damaging 1.00
R0498:Piezo2 UTSW 18 63,102,174 (GRCm38) missense possibly damaging 0.87
R0504:Piezo2 UTSW 18 63,024,451 (GRCm38) missense probably damaging 1.00
R0506:Piezo2 UTSW 18 63,027,544 (GRCm38) missense probably damaging 1.00
R0523:Piezo2 UTSW 18 63,022,481 (GRCm38) missense probably damaging 1.00
R0587:Piezo2 UTSW 18 63,022,426 (GRCm38) missense possibly damaging 0.82
R0626:Piezo2 UTSW 18 63,019,258 (GRCm38) missense probably damaging 0.97
R0734:Piezo2 UTSW 18 63,041,723 (GRCm38) missense probably damaging 1.00
R0784:Piezo2 UTSW 18 63,083,235 (GRCm38) missense probably damaging 1.00
R0973:Piezo2 UTSW 18 63,015,802 (GRCm38) missense probably damaging 1.00
R1183:Piezo2 UTSW 18 63,086,753 (GRCm38) missense probably damaging 1.00
R1344:Piezo2 UTSW 18 63,021,254 (GRCm38) missense probably damaging 1.00
R1474:Piezo2 UTSW 18 63,083,131 (GRCm38) missense probably damaging 1.00
R1571:Piezo2 UTSW 18 63,144,919 (GRCm38) missense possibly damaging 0.67
R1643:Piezo2 UTSW 18 63,082,915 (GRCm38) missense probably benign 0.03
R1649:Piezo2 UTSW 18 63,117,672 (GRCm38) missense probably benign 0.34
R1741:Piezo2 UTSW 18 63,021,173 (GRCm38) missense probably damaging 1.00
R1764:Piezo2 UTSW 18 63,124,642 (GRCm38) missense possibly damaging 0.50
R1793:Piezo2 UTSW 18 63,106,284 (GRCm38) missense possibly damaging 0.78
R1799:Piezo2 UTSW 18 63,108,087 (GRCm38) missense probably damaging 1.00
R1799:Piezo2 UTSW 18 63,032,840 (GRCm38) critical splice donor site probably null
R1868:Piezo2 UTSW 18 63,019,344 (GRCm38) missense probably damaging 1.00
R1879:Piezo2 UTSW 18 63,113,960 (GRCm38) missense probably damaging 1.00
R1962:Piezo2 UTSW 18 63,078,840 (GRCm38) missense probably damaging 0.98
R1990:Piezo2 UTSW 18 63,074,662 (GRCm38) missense probably null 1.00
R1991:Piezo2 UTSW 18 63,074,662 (GRCm38) missense probably null 1.00
R1992:Piezo2 UTSW 18 63,074,662 (GRCm38) missense probably null 1.00
R1995:Piezo2 UTSW 18 63,078,781 (GRCm38) missense probably damaging 1.00
R2004:Piezo2 UTSW 18 63,144,926 (GRCm38) missense probably damaging 1.00
R2011:Piezo2 UTSW 18 63,059,744 (GRCm38) missense probably damaging 1.00
R2029:Piezo2 UTSW 18 63,118,935 (GRCm38) missense possibly damaging 0.62
R2075:Piezo2 UTSW 18 63,081,734 (GRCm38) missense probably damaging 1.00
R2078:Piezo2 UTSW 18 63,117,720 (GRCm38) missense probably damaging 0.99
R2152:Piezo2 UTSW 18 63,114,041 (GRCm38) missense probably damaging 1.00
R2162:Piezo2 UTSW 18 63,081,662 (GRCm38) critical splice donor site probably null
R2183:Piezo2 UTSW 18 63,106,274 (GRCm38) missense probably damaging 1.00
R2230:Piezo2 UTSW 18 63,145,072 (GRCm38) missense probably damaging 1.00
R2231:Piezo2 UTSW 18 63,145,072 (GRCm38) missense probably damaging 1.00
R2406:Piezo2 UTSW 18 63,022,525 (GRCm38) missense probably damaging 1.00
R2431:Piezo2 UTSW 18 63,245,624 (GRCm38) missense possibly damaging 0.95
R2876:Piezo2 UTSW 18 63,053,035 (GRCm38) missense probably damaging 1.00
R2935:Piezo2 UTSW 18 63,146,843 (GRCm38) missense probably damaging 1.00
R3004:Piezo2 UTSW 18 63,024,435 (GRCm38) nonsense probably null
R3016:Piezo2 UTSW 18 63,042,832 (GRCm38) missense probably damaging 1.00
R3794:Piezo2 UTSW 18 63,081,793 (GRCm38) missense probably damaging 0.99
R3832:Piezo2 UTSW 18 63,081,662 (GRCm38) critical splice donor site probably null
R3833:Piezo2 UTSW 18 63,081,662 (GRCm38) critical splice donor site probably null
R3968:Piezo2 UTSW 18 63,011,696 (GRCm38) missense probably damaging 1.00
R3969:Piezo2 UTSW 18 63,011,696 (GRCm38) missense probably damaging 1.00
R3970:Piezo2 UTSW 18 63,011,696 (GRCm38) missense probably damaging 1.00
R4169:Piezo2 UTSW 18 63,050,604 (GRCm38) missense probably benign
R4181:Piezo2 UTSW 18 63,124,730 (GRCm38) critical splice acceptor site probably null
R4301:Piezo2 UTSW 18 63,084,840 (GRCm38) missense probably damaging 1.00
R4302:Piezo2 UTSW 18 63,124,730 (GRCm38) critical splice acceptor site probably null
R4475:Piezo2 UTSW 18 63,102,099 (GRCm38) missense probably damaging 1.00
R4493:Piezo2 UTSW 18 63,114,063 (GRCm38) missense probably damaging 0.98
R4519:Piezo2 UTSW 18 63,072,880 (GRCm38) missense probably damaging 1.00
R4539:Piezo2 UTSW 18 63,086,628 (GRCm38) missense probably damaging 1.00
R4687:Piezo2 UTSW 18 63,069,963 (GRCm38) missense probably damaging 1.00
R4732:Piezo2 UTSW 18 63,030,401 (GRCm38) missense probably damaging 1.00
R4733:Piezo2 UTSW 18 63,030,401 (GRCm38) missense probably damaging 1.00
R4825:Piezo2 UTSW 18 63,144,954 (GRCm38) missense probably damaging 0.98
R4899:Piezo2 UTSW 18 63,078,791 (GRCm38) missense possibly damaging 0.84
R4946:Piezo2 UTSW 18 63,157,262 (GRCm38) missense probably benign
R4961:Piezo2 UTSW 18 63,052,961 (GRCm38) splice site probably null
R4968:Piezo2 UTSW 18 63,144,971 (GRCm38) nonsense probably null
R4973:Piezo2 UTSW 18 63,074,680 (GRCm38) missense probably damaging 1.00
R4997:Piezo2 UTSW 18 63,083,113 (GRCm38) missense probably damaging 1.00
R5078:Piezo2 UTSW 18 63,024,536 (GRCm38) missense probably damaging 1.00
R5134:Piezo2 UTSW 18 63,074,620 (GRCm38) missense probably damaging 1.00
R5151:Piezo2 UTSW 18 63,030,409 (GRCm38) missense possibly damaging 0.72
R5209:Piezo2 UTSW 18 63,032,929 (GRCm38) missense probably damaging 1.00
R5367:Piezo2 UTSW 18 63,064,731 (GRCm38) missense probably damaging 1.00
R5401:Piezo2 UTSW 18 63,084,740 (GRCm38) missense possibly damaging 0.81
R5464:Piezo2 UTSW 18 63,145,105 (GRCm38) missense probably damaging 1.00
R5469:Piezo2 UTSW 18 63,027,864 (GRCm38) missense probably damaging 1.00
R5650:Piezo2 UTSW 18 63,011,721 (GRCm38) missense probably damaging 1.00
R5654:Piezo2 UTSW 18 63,145,091 (GRCm38) missense possibly damaging 0.94
R5677:Piezo2 UTSW 18 63,117,697 (GRCm38) missense probably benign 0.25
R5677:Piezo2 UTSW 18 63,117,696 (GRCm38) missense possibly damaging 0.94
R5792:Piezo2 UTSW 18 63,146,856 (GRCm38) missense probably damaging 1.00
R5874:Piezo2 UTSW 18 63,027,901 (GRCm38) missense probably damaging 1.00
R5877:Piezo2 UTSW 18 63,113,934 (GRCm38) missense probably benign 0.22
R6036:Piezo2 UTSW 18 63,114,948 (GRCm38) nonsense probably null
R6036:Piezo2 UTSW 18 63,114,948 (GRCm38) nonsense probably null
R6073:Piezo2 UTSW 18 63,012,645 (GRCm38) missense probably damaging 1.00
R6198:Piezo2 UTSW 18 63,157,210 (GRCm38) nonsense probably null
R6255:Piezo2 UTSW 18 63,121,270 (GRCm38) missense possibly damaging 0.75
R6259:Piezo2 UTSW 18 63,117,678 (GRCm38) missense possibly damaging 0.69
R6391:Piezo2 UTSW 18 63,106,293 (GRCm38) missense possibly damaging 0.79
R6446:Piezo2 UTSW 18 63,086,607 (GRCm38) missense probably damaging 1.00
R6518:Piezo2 UTSW 18 63,106,271 (GRCm38) missense probably damaging 0.99
R6521:Piezo2 UTSW 18 63,021,328 (GRCm38) missense probably damaging 1.00
R6625:Piezo2 UTSW 18 63,021,262 (GRCm38) missense probably damaging 1.00
R6744:Piezo2 UTSW 18 63,032,889 (GRCm38) nonsense probably null
R6855:Piezo2 UTSW 18 63,090,879 (GRCm38) critical splice donor site probably null
R6927:Piezo2 UTSW 18 63,032,986 (GRCm38) missense probably damaging 1.00
R6980:Piezo2 UTSW 18 63,082,961 (GRCm38) critical splice acceptor site probably null
R7141:Piezo2 UTSW 18 63,145,110 (GRCm38) nonsense probably null
R7162:Piezo2 UTSW 18 63,124,709 (GRCm38) missense possibly damaging 0.50
R7331:Piezo2 UTSW 18 63,108,030 (GRCm38) missense probably damaging 0.99
R7382:Piezo2 UTSW 18 63,017,519 (GRCm38) splice site probably null
R7395:Piezo2 UTSW 18 63,027,563 (GRCm38) missense probably damaging 1.00
R7448:Piezo2 UTSW 18 63,024,472 (GRCm38) missense probably damaging 1.00
R7465:Piezo2 UTSW 18 63,012,723 (GRCm38) missense probably benign
R7517:Piezo2 UTSW 18 63,082,925 (GRCm38) missense possibly damaging 0.52
R7577:Piezo2 UTSW 18 63,053,010 (GRCm38) missense probably benign 0.01
R7612:Piezo2 UTSW 18 63,042,539 (GRCm38) missense probably benign 0.12
R7829:Piezo2 UTSW 18 63,113,876 (GRCm38) critical splice donor site probably null
R7835:Piezo2 UTSW 18 63,082,945 (GRCm38) missense probably benign 0.12
R8014:Piezo2 UTSW 18 63,083,200 (GRCm38) missense probably benign 0.02
R8055:Piezo2 UTSW 18 63,042,811 (GRCm38) missense probably damaging 0.99
R8062:Piezo2 UTSW 18 63,030,466 (GRCm38) missense possibly damaging 0.87
R8306:Piezo2 UTSW 18 63,075,730 (GRCm38) missense probably damaging 1.00
R8332:Piezo2 UTSW 18 63,012,786 (GRCm38) missense possibly damaging 0.67
R8355:Piezo2 UTSW 18 63,090,998 (GRCm38) missense probably damaging 1.00
R8383:Piezo2 UTSW 18 63,084,688 (GRCm38) missense probably damaging 0.97
R8455:Piezo2 UTSW 18 63,090,998 (GRCm38) missense probably damaging 1.00
R8501:Piezo2 UTSW 18 63,045,540 (GRCm38) missense probably damaging 0.99
R8523:Piezo2 UTSW 18 63,146,802 (GRCm38) missense probably damaging 0.99
R8692:Piezo2 UTSW 18 63,092,900 (GRCm38) nonsense probably null
R8708:Piezo2 UTSW 18 63,093,015 (GRCm38) missense probably damaging 1.00
R8726:Piezo2 UTSW 18 63,109,885 (GRCm38) missense probably benign
R8727:Piezo2 UTSW 18 63,109,885 (GRCm38) missense probably benign
R8810:Piezo2 UTSW 18 63,114,963 (GRCm38) missense probably benign 0.41
R8900:Piezo2 UTSW 18 63,115,025 (GRCm38) missense probably benign 0.04
R9037:Piezo2 UTSW 18 63,092,831 (GRCm38) missense probably benign 0.31
R9079:Piezo2 UTSW 18 63,024,466 (GRCm38) missense probably damaging 1.00
R9090:Piezo2 UTSW 18 63,075,719 (GRCm38) missense probably damaging 0.99
R9090:Piezo2 UTSW 18 63,030,379 (GRCm38) missense probably damaging 0.99
R9123:Piezo2 UTSW 18 63,045,518 (GRCm38) missense probably benign 0.00
R9125:Piezo2 UTSW 18 63,045,518 (GRCm38) missense probably benign 0.00
R9171:Piezo2 UTSW 18 63,045,479 (GRCm38) missense probably benign 0.04
R9194:Piezo2 UTSW 18 63,117,744 (GRCm38) missense probably benign 0.03
R9203:Piezo2 UTSW 18 63,157,231 (GRCm38) missense probably benign 0.00
R9209:Piezo2 UTSW 18 63,021,301 (GRCm38) missense probably damaging 1.00
R9261:Piezo2 UTSW 18 63,075,797 (GRCm38) missense possibly damaging 0.84
R9271:Piezo2 UTSW 18 63,030,379 (GRCm38) missense probably damaging 0.99
R9271:Piezo2 UTSW 18 63,075,719 (GRCm38) missense probably damaging 0.99
R9283:Piezo2 UTSW 18 63,024,566 (GRCm38) missense probably damaging 1.00
R9377:Piezo2 UTSW 18 63,029,085 (GRCm38) missense possibly damaging 0.48
R9499:Piezo2 UTSW 18 63,032,962 (GRCm38) missense possibly damaging 0.67
R9531:Piezo2 UTSW 18 63,102,165 (GRCm38) missense possibly damaging 0.95
R9551:Piezo2 UTSW 18 63,032,962 (GRCm38) missense possibly damaging 0.67
R9607:Piezo2 UTSW 18 63,386,276 (GRCm38) start gained probably benign
R9608:Piezo2 UTSW 18 63,146,945 (GRCm38) missense probably benign 0.09
R9617:Piezo2 UTSW 18 63,115,037 (GRCm38) missense probably benign 0.43
R9624:Piezo2 UTSW 18 63,064,696 (GRCm38) missense possibly damaging 0.88
X0017:Piezo2 UTSW 18 63,027,586 (GRCm38) missense probably damaging 0.99
X0022:Piezo2 UTSW 18 63,050,610 (GRCm38) missense probably benign 0.43
X0060:Piezo2 UTSW 18 63,017,577 (GRCm38) missense probably benign 0.09
Z1088:Piezo2 UTSW 18 63,069,994 (GRCm38) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCAGTACTAGGCCACATTGCTG -3'
(R):5'- GATCACACGGGTGTAAGTCAG -3'

Sequencing Primer
(F):5'- GCTGACCATGATTGCCAGTCTAAG -3'
(R):5'- CACACGGGTGTAAGTCAGTGATTTG -3'
Posted On 2018-05-21