Incidental Mutation 'R6465:Nedd4l'
ID517801
Institutional Source Beutler Lab
Gene Symbol Nedd4l
Ensembl Gene ENSMUSG00000024589
Gene Nameneural precursor cell expressed, developmentally down-regulated gene 4-like
SynonymsNedd4-2, Nedd4b, 1300012C07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R6465 (G1)
Quality Score215.009
Status Validated
Chromosome18
Chromosomal Location64887705-65217831 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 65155264 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 119 (D119E)
Ref Sequence ENSEMBL: ENSMUSP00000132838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080418] [ENSMUST00000163516] [ENSMUST00000224347] [ENSMUST00000224385] [ENSMUST00000225057] [ENSMUST00000225261] [ENSMUST00000226058]
Predicted Effect probably benign
Transcript: ENSMUST00000080418
SMART Domains Protein: ENSMUSP00000079280
Gene: ENSMUSG00000024589

DomainStartEndE-ValueType
PDB:3M7F|B 1 64 2e-21 PDB
WW 73 105 2.32e-13 SMART
low complexity region 139 154 N/A INTRINSIC
low complexity region 166 178 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
WW 266 298 2.08e-15 SMART
low complexity region 355 371 N/A INTRINSIC
WW 378 410 4.1e-14 SMART
WW 429 461 1.53e-13 SMART
HECTc 518 854 3.04e-183 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163516
AA Change: D119E

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000132838
Gene: ENSMUSG00000024589
AA Change: D119E

DomainStartEndE-ValueType
C2 21 124 1.76e-25 SMART
WW 194 226 2.32e-13 SMART
low complexity region 260 275 N/A INTRINSIC
low complexity region 287 299 N/A INTRINSIC
low complexity region 355 368 N/A INTRINSIC
WW 387 419 2.08e-15 SMART
low complexity region 476 492 N/A INTRINSIC
WW 499 531 4.1e-14 SMART
WW 550 582 1.53e-13 SMART
HECTc 639 975 3.04e-183 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224347
Predicted Effect probably benign
Transcript: ENSMUST00000224385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224663
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224890
Predicted Effect probably benign
Transcript: ENSMUST00000225057
Predicted Effect probably benign
Transcript: ENSMUST00000225261
Predicted Effect probably benign
Transcript: ENSMUST00000226058
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein mediates the ubiquitination of multiple target substrates and plays a critical role in epithelial sodium transport by regulating the cell surface expression of the epithelial sodium channel, ENaC. Single nucleotide polymorphisms in this gene may be associated with essential hypertension. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null mutation display salt sensitive hypertension and high salt diet induced cardiac hypertrophy. A spontaneous mutation results in overt diabetes insipidus. Mice homozygous for a knock-out allele exhibit neonatal lethality with primary atelectasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230113P08Rik A T 9: 35,908,625 N25Y possibly damaging Het
A2ml1 G A 6: 128,541,078 T1415I probably damaging Het
Acvr2b T A 9: 119,433,303 W461R probably damaging Het
Adam23 G T 1: 63,566,668 C637F probably damaging Het
Apol8 T G 15: 77,749,948 T143P probably benign Het
Asna1 A T 8: 85,018,565 M291K probably benign Het
Bfsp1 A C 2: 143,858,055 probably null Het
Cytl1 T C 5: 37,737,670 V99A probably benign Het
Dock2 A T 11: 34,503,413 V793E probably damaging Het
Fxyd5 G T 7: 31,037,880 T81K probably damaging Het
Gcm1 A G 9: 78,064,869 Y364C probably damaging Het
Gm37596 A G 3: 93,692,996 I22T probably damaging Het
Gm9992 G T 17: 7,374,443 T202K probably damaging Het
Haghl T C 17: 25,783,819 N190S possibly damaging Het
Inpp5j C A 11: 3,502,293 R319L possibly damaging Het
Ints10 A G 8: 68,807,536 N304S probably benign Het
Isoc1 T A 18: 58,671,256 C119S probably damaging Het
Klhl18 A G 9: 110,428,920 M414T probably benign Het
Krtap2-4 A G 11: 99,614,759 probably benign Het
Krtap3-1 G A 11: 99,566,451 P45S possibly damaging Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Myo7a A G 7: 98,062,680 V1754A possibly damaging Het
Nsun7 T C 5: 66,295,586 V548A probably benign Het
Olfr1024 A T 2: 85,904,539 S172T probably benign Het
Olfr711 A T 7: 106,972,212 V44E possibly damaging Het
Parvg A G 15: 84,328,940 D127G probably damaging Het
Piezo2 T A 18: 63,041,663 M2007L possibly damaging Het
Pou2f3 A C 9: 43,139,867 F175V probably damaging Het
Ptprn2 T C 12: 117,269,589 I958T probably damaging Het
Pwwp2b T C 7: 139,256,035 V464A probably benign Het
Pzp A G 6: 128,491,619 Y982H probably damaging Het
Rad17 T A 13: 100,637,080 N202I probably benign Het
Rtel1 T A 2: 181,335,940 D271E possibly damaging Het
Sos2 T C 12: 69,596,775 S943G probably benign Het
Tm9sf2 A G 14: 122,141,207 H241R probably benign Het
Ttc8 A G 12: 98,964,570 E291G probably damaging Het
Wfikkn1 A G 17: 25,878,718 C211R probably damaging Het
Ylpm1 T A 12: 85,049,802 D1219E probably damaging Het
Zc3hav1 T C 6: 38,331,849 Y586C possibly damaging Het
Zcchc4 T A 5: 52,819,276 F471I probably benign Het
Zfp719 C A 7: 43,590,684 Y565* probably null Het
Other mutations in Nedd4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Nedd4l APN 18 65208092 missense probably damaging 1.00
IGL00931:Nedd4l APN 18 65172399 missense possibly damaging 0.57
IGL02306:Nedd4l APN 18 65172954 missense possibly damaging 0.64
IGL02363:Nedd4l APN 18 65208045 splice site probably benign
IGL02440:Nedd4l APN 18 65163173 critical splice donor site probably null
IGL02444:Nedd4l APN 18 65203957 splice site probably benign
IGL02700:Nedd4l APN 18 65209680 missense probably damaging 1.00
IGL02943:Nedd4l APN 18 65161652 critical splice donor site probably null
IGL02999:Nedd4l APN 18 65198707 missense probably damaging 1.00
IGL03135:Nedd4l APN 18 65205670 missense probably damaging 1.00
IGL03373:Nedd4l APN 18 65181320 splice site probably benign
R0036:Nedd4l UTSW 18 65051123 intron probably benign
R0396:Nedd4l UTSW 18 65161654 splice site probably benign
R0472:Nedd4l UTSW 18 65208461 missense probably damaging 1.00
R0494:Nedd4l UTSW 18 65173021 missense possibly damaging 0.69
R0513:Nedd4l UTSW 18 65195185 splice site probably benign
R0609:Nedd4l UTSW 18 65208461 missense probably damaging 1.00
R0631:Nedd4l UTSW 18 65208503 splice site probably benign
R1077:Nedd4l UTSW 18 65167499 splice site probably benign
R1643:Nedd4l UTSW 18 65198641 missense probably damaging 1.00
R1722:Nedd4l UTSW 18 65157939 missense probably damaging 1.00
R1806:Nedd4l UTSW 18 65212791 missense probably damaging 1.00
R1921:Nedd4l UTSW 18 65167575 critical splice donor site probably null
R1986:Nedd4l UTSW 18 65143803 missense probably damaging 1.00
R2070:Nedd4l UTSW 18 65212820 missense probably damaging 1.00
R2151:Nedd4l UTSW 18 65210330 missense probably damaging 1.00
R2152:Nedd4l UTSW 18 65210330 missense probably damaging 1.00
R2154:Nedd4l UTSW 18 65210330 missense probably damaging 1.00
R2358:Nedd4l UTSW 18 65209719 missense possibly damaging 0.51
R2680:Nedd4l UTSW 18 65163130 missense possibly damaging 0.85
R3082:Nedd4l UTSW 18 65178978 missense probably benign 0.00
R3500:Nedd4l UTSW 18 65212860 missense probably damaging 1.00
R3711:Nedd4l UTSW 18 65209719 missense possibly damaging 0.51
R3712:Nedd4l UTSW 18 65209719 missense possibly damaging 0.51
R3874:Nedd4l UTSW 18 65167535 missense probably benign
R4435:Nedd4l UTSW 18 65212825 missense possibly damaging 0.84
R4698:Nedd4l UTSW 18 65203880 missense probably damaging 1.00
R4757:Nedd4l UTSW 18 65165605 missense probably damaging 0.98
R4783:Nedd4l UTSW 18 65172927 missense probably damaging 0.99
R4790:Nedd4l UTSW 18 65203945 missense possibly damaging 0.94
R4980:Nedd4l UTSW 18 65080060 nonsense probably null
R5106:Nedd4l UTSW 18 65193305 missense probably damaging 1.00
R5122:Nedd4l UTSW 18 65191447 missense probably damaging 1.00
R5605:Nedd4l UTSW 18 65174244 critical splice donor site probably null
R6479:Nedd4l UTSW 18 65209681 missense probably damaging 1.00
R6622:Nedd4l UTSW 18 65174234 missense probably damaging 0.99
R6773:Nedd4l UTSW 18 65167551 missense probably benign 0.36
R7065:Nedd4l UTSW 18 65195969 missense probably benign 0.04
R7068:Nedd4l UTSW 18 65205651 missense probably damaging 1.00
R7193:Nedd4l UTSW 18 64997370 missense probably damaging 1.00
R7496:Nedd4l UTSW 18 65080018 missense possibly damaging 0.94
R7903:Nedd4l UTSW 18 65186367 missense probably damaging 1.00
R8123:Nedd4l UTSW 18 65074774 missense probably damaging 1.00
R8185:Nedd4l UTSW 18 65209698 missense probably damaging 1.00
R8282:Nedd4l UTSW 18 65191489 missense probably damaging 0.98
R8440:Nedd4l UTSW 18 64889055 splice site probably null
R8499:Nedd4l UTSW 18 65209657 missense probably damaging 0.98
R8557:Nedd4l UTSW 18 65203915 missense probably benign 0.00
R8801:Nedd4l UTSW 18 65155275 missense probably damaging 1.00
RF013:Nedd4l UTSW 18 65209680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGACAAGCTTCTGTGGGCC -3'
(R):5'- CTGTCCTCAGAGAAAGCAGC -3'

Sequencing Primer
(F):5'- AAGCTTCTGTGGGCCTGGAAG -3'
(R):5'- TGTCCTCAGAGAAAGCAGCACTAC -3'
Posted On2018-05-21