Mutagenetix > Incidental Mutation

Incidental Mutation 'R6465:Nedd4l'

517801

Institutional Source

Beutler Lab

Gene Symbol

Nedd4l

Ensembl Gene

ENSMUSG00000024589

Gene Name

neural precursor cell expressed, developmentally down-regulated gene 4-like

Synonyms

Nedd4-2, Nedd4b, 1300012C07Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.201) question?

Stock #

R6465 (G1)

Quality Score

215.009

Status

Validated

Chromosome

Chromosomal Location

64887705-65217831 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 65155264 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 119 (D119E)

Ref Sequence

ENSEMBL: ENSMUSP00000132838 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080418] [ENSMUST00000163516] [ENSMUST00000224347] [ENSMUST00000224385] [ENSMUST00000225057] [ENSMUST00000225261] [ENSMUST00000226058]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000080418

SMART Domains

Protein: ENSMUSP00000079280
Gene: ENSMUSG00000024589

Domain	Start	End	E-Value	Type
PDB:3M7F\|B	1	64	2e-21	PDB
WW	73	105	2.32e-13	SMART
low complexity region	139	154	N/A	INTRINSIC
low complexity region	166	178	N/A	INTRINSIC
low complexity region	234	247	N/A	INTRINSIC
WW	266	298	2.08e-15	SMART
low complexity region	355	371	N/A	INTRINSIC
WW	378	410	4.1e-14	SMART
WW	429	461	1.53e-13	SMART
HECTc	518	854	3.04e-183	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000163516
AA Change: D119E

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000132838
Gene: ENSMUSG00000024589
AA Change: D119E

Domain	Start	End	E-Value	Type
C2	21	124	1.76e-25	SMART
WW	194	226	2.32e-13	SMART
low complexity region	260	275	N/A	INTRINSIC
low complexity region	287	299	N/A	INTRINSIC
low complexity region	355	368	N/A	INTRINSIC
WW	387	419	2.08e-15	SMART
low complexity region	476	492	N/A	INTRINSIC
WW	499	531	4.1e-14	SMART
WW	550	582	1.53e-13	SMART
HECTc	639	975	3.04e-183	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000224347

Predicted Effect

probably benign
Transcript: ENSMUST00000224385

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224663

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224890

Predicted Effect

probably benign
Transcript: ENSMUST00000225057

Predicted Effect

probably benign
Transcript: ENSMUST00000225261

Predicted Effect

probably benign
Transcript: ENSMUST00000226058

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.8%
20x: 93.1%

Validation Efficiency

95% (40/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein mediates the ubiquitination of multiple target substrates and plays a critical role in epithelial sodium transport by regulating the cell surface expression of the epithelial sodium channel, ENaC. Single nucleotide polymorphisms in this gene may be associated with essential hypertension. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null mutation display salt sensitive hypertension and high salt diet induced cardiac hypertrophy. A spontaneous mutation results in overt diabetes insipidus. Mice homozygous for a knock-out allele exhibit neonatal lethality with primary atelectasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230113P08Rik	A	T	9: 35,908,625	N25Y	possibly damaging	Het
A2ml1	G	A	6: 128,541,078	T1415I	probably damaging	Het
Acvr2b	T	A	9: 119,433,303	W461R	probably damaging	Het
Adam23	G	T	1: 63,566,668	C637F	probably damaging	Het
Apol8	T	G	15: 77,749,948	T143P	probably benign	Het
Asna1	A	T	8: 85,018,565	M291K	probably benign	Het
Bfsp1	A	C	2: 143,858,055		probably null	Het
Cytl1	T	C	5: 37,737,670	V99A	probably benign	Het
Dock2	A	T	11: 34,503,413	V793E	probably damaging	Het
Fxyd5	G	T	7: 31,037,880	T81K	probably damaging	Het
Gcm1	A	G	9: 78,064,869	Y364C	probably damaging	Het
Gm37596	A	G	3: 93,692,996	I22T	probably damaging	Het
Gm9992	G	T	17: 7,374,443	T202K	probably damaging	Het
Haghl	T	C	17: 25,783,819	N190S	possibly damaging	Het
Inpp5j	C	A	11: 3,502,293	R319L	possibly damaging	Het
Ints10	A	G	8: 68,807,536	N304S	probably benign	Het
Isoc1	T	A	18: 58,671,256	C119S	probably damaging	Het
Klhl18	A	G	9: 110,428,920	M414T	probably benign	Het
Krtap2-4	A	G	11: 99,614,759		probably benign	Het
Krtap3-1	G	A	11: 99,566,451	P45S	possibly damaging	Het
Mroh2a	GCCC	GC	1: 88,232,257		probably null	Het
Myo7a	A	G	7: 98,062,680	V1754A	possibly damaging	Het
Nsun7	T	C	5: 66,295,586	V548A	probably benign	Het
Olfr1024	A	T	2: 85,904,539	S172T	probably benign	Het
Olfr711	A	T	7: 106,972,212	V44E	possibly damaging	Het
Parvg	A	G	15: 84,328,940	D127G	probably damaging	Het
Piezo2	T	A	18: 63,041,663	M2007L	possibly damaging	Het
Pou2f3	A	C	9: 43,139,867	F175V	probably damaging	Het
Ptprn2	T	C	12: 117,269,589	I958T	probably damaging	Het
Pwwp2b	T	C	7: 139,256,035	V464A	probably benign	Het
Pzp	A	G	6: 128,491,619	Y982H	probably damaging	Het
Rad17	T	A	13: 100,637,080	N202I	probably benign	Het
Rtel1	T	A	2: 181,335,940	D271E	possibly damaging	Het
Sos2	T	C	12: 69,596,775	S943G	probably benign	Het
Tm9sf2	A	G	14: 122,141,207	H241R	probably benign	Het
Ttc8	A	G	12: 98,964,570	E291G	probably damaging	Het
Wfikkn1	A	G	17: 25,878,718	C211R	probably damaging	Het
Ylpm1	T	A	12: 85,049,802	D1219E	probably damaging	Het
Zc3hav1	T	C	6: 38,331,849	Y586C	possibly damaging	Het
Zcchc4	T	A	5: 52,819,276	F471I	probably benign	Het
Zfp719	C	A	7: 43,590,684	Y565*	probably null	Het

Other mutations in Nedd4l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00501:Nedd4l	APN	18	65208092	missense	probably damaging	1.00
IGL00931:Nedd4l	APN	18	65172399	missense	possibly damaging	0.57
IGL02306:Nedd4l	APN	18	65172954	missense	possibly damaging	0.64
IGL02363:Nedd4l	APN	18	65208045	splice site	probably benign
IGL02440:Nedd4l	APN	18	65163173	critical splice donor site	probably null
IGL02444:Nedd4l	APN	18	65203957	splice site	probably benign
IGL02700:Nedd4l	APN	18	65209680	missense	probably damaging	1.00
IGL02943:Nedd4l	APN	18	65161652	critical splice donor site	probably null
IGL02999:Nedd4l	APN	18	65198707	missense	probably damaging	1.00
IGL03135:Nedd4l	APN	18	65205670	missense	probably damaging	1.00
IGL03373:Nedd4l	APN	18	65181320	splice site	probably benign
R0036:Nedd4l	UTSW	18	65051123	intron	probably benign
R0396:Nedd4l	UTSW	18	65161654	splice site	probably benign
R0472:Nedd4l	UTSW	18	65208461	missense	probably damaging	1.00
R0494:Nedd4l	UTSW	18	65173021	missense	possibly damaging	0.69
R0513:Nedd4l	UTSW	18	65195185	splice site	probably benign
R0609:Nedd4l	UTSW	18	65208461	missense	probably damaging	1.00
R0631:Nedd4l	UTSW	18	65208503	splice site	probably benign
R1077:Nedd4l	UTSW	18	65167499	splice site	probably benign
R1643:Nedd4l	UTSW	18	65198641	missense	probably damaging	1.00
R1722:Nedd4l	UTSW	18	65157939	missense	probably damaging	1.00
R1806:Nedd4l	UTSW	18	65212791	missense	probably damaging	1.00
R1921:Nedd4l	UTSW	18	65167575	critical splice donor site	probably null
R1986:Nedd4l	UTSW	18	65143803	missense	probably damaging	1.00
R2070:Nedd4l	UTSW	18	65212820	missense	probably damaging	1.00
R2151:Nedd4l	UTSW	18	65210330	missense	probably damaging	1.00
R2152:Nedd4l	UTSW	18	65210330	missense	probably damaging	1.00
R2154:Nedd4l	UTSW	18	65210330	missense	probably damaging	1.00
R2358:Nedd4l	UTSW	18	65209719	missense	possibly damaging	0.51
R2680:Nedd4l	UTSW	18	65163130	missense	possibly damaging	0.85
R3082:Nedd4l	UTSW	18	65178978	missense	probably benign	0.00
R3500:Nedd4l	UTSW	18	65212860	missense	probably damaging	1.00
R3711:Nedd4l	UTSW	18	65209719	missense	possibly damaging	0.51
R3712:Nedd4l	UTSW	18	65209719	missense	possibly damaging	0.51
R3874:Nedd4l	UTSW	18	65167535	missense	probably benign
R4435:Nedd4l	UTSW	18	65212825	missense	possibly damaging	0.84
R4698:Nedd4l	UTSW	18	65203880	missense	probably damaging	1.00
R4757:Nedd4l	UTSW	18	65165605	missense	probably damaging	0.98
R4783:Nedd4l	UTSW	18	65172927	missense	probably damaging	0.99
R4790:Nedd4l	UTSW	18	65203945	missense	possibly damaging	0.94
R4980:Nedd4l	UTSW	18	65080060	nonsense	probably null
R5106:Nedd4l	UTSW	18	65193305	missense	probably damaging	1.00
R5122:Nedd4l	UTSW	18	65191447	missense	probably damaging	1.00
R5605:Nedd4l	UTSW	18	65174244	critical splice donor site	probably null
R6479:Nedd4l	UTSW	18	65209681	missense	probably damaging	1.00
R6622:Nedd4l	UTSW	18	65174234	missense	probably damaging	0.99
R6773:Nedd4l	UTSW	18	65167551	missense	probably benign	0.36
R7065:Nedd4l	UTSW	18	65195969	missense	probably benign	0.04
R7068:Nedd4l	UTSW	18	65205651	missense	probably damaging	1.00
R7193:Nedd4l	UTSW	18	64997370	missense	probably damaging	1.00
R7496:Nedd4l	UTSW	18	65080018	missense	possibly damaging	0.94
R7903:Nedd4l	UTSW	18	65186367	missense	probably damaging	1.00
R8123:Nedd4l	UTSW	18	65074774	missense	probably damaging	1.00
R8185:Nedd4l	UTSW	18	65209698	missense	probably damaging	1.00
R8282:Nedd4l	UTSW	18	65191489	missense	probably damaging	0.98
R8440:Nedd4l	UTSW	18	64889055	splice site	probably null
R8499:Nedd4l	UTSW	18	65209657	missense	probably damaging	0.98
R8557:Nedd4l	UTSW	18	65203915	missense	probably benign	0.00
R8801:Nedd4l	UTSW	18	65155275	missense	probably damaging	1.00
R8896:Nedd4l	UTSW	18	65165617	missense	probably benign
R9025:Nedd4l	UTSW	18	65178924	missense	probably damaging	0.98
R9040:Nedd4l	UTSW	18	65209663	missense	probably damaging	0.99
R9482:Nedd4l	UTSW	18	64887960	unclassified	probably benign
R9498:Nedd4l	UTSW	18	65161652	critical splice donor site	probably null
R9599:Nedd4l	UTSW	18	65210329	missense	probably damaging	1.00
RF013:Nedd4l	UTSW	18	65209680	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAGACAAGCTTCTGTGGGCC -3'
(R):5'- CTGTCCTCAGAGAAAGCAGC -3'

Sequencing Primer
(F):5'- AAGCTTCTGTGGGCCTGGAAG -3'
(R):5'- TGTCCTCAGAGAAAGCAGCACTAC -3'

Posted On

2018-05-21