Mutagenetix > Incidental Mutations

Incidental Mutation 'R6481:Tshz3'

517819

Institutional Source

Beutler Lab

Gene Symbol

Tshz3

Ensembl Gene

ENSMUSG00000021217

Gene Name

teashirt zinc finger family member 3

Synonyms

Tsh3, teashirt3, A630038G13Rik, Zfp537

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6481 (G1)

Quality Score

116.008

Status

Validated

Chromosome

Chromosomal Location

36698118-36773553 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

A to G at 36752339 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000021641 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021641]

Predicted Effect

probably null
Transcript: ENSMUST00000021641

SMART Domains

Protein: ENSMUSP00000021641
Gene: ENSMUSG00000021217

Domain	Start	End	E-Value	Type
low complexity region	2	14	N/A	INTRINSIC
low complexity region	123	138	N/A	INTRINSIC
low complexity region	142	164	N/A	INTRINSIC
ZnF_C2H2	214	238	1.86e0	SMART
ZnF_C2H2	275	299	3.83e-2	SMART
low complexity region	313	334	N/A	INTRINSIC
ZnF_C2H2	386	410	5.62e0	SMART
low complexity region	483	497	N/A	INTRINSIC
coiled coil region	609	630	N/A	INTRINSIC
low complexity region	796	832	N/A	INTRINSIC
low complexity region	855	872	N/A	INTRINSIC
HOX	890	964	2.55e-4	SMART
ZnF_C2H2	976	998	8.09e0	SMART
ZnF_C2H2	1041	1064	2.4e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158648

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.2%

Validation Efficiency

100% (82/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc-finger transcription factor that regulates smooth muscle cell differentiation in the developing urinary tract. Consistent with this role, mice in which this gene has been inactivated exhibit abnormal gene expression in urinary tract smooth muscle cell precursors and kidney defects including hydronephrosis. The encoded transcription factor comprises a gene silencing complex that inhibits caspase expression. Reduced expression of this gene and consequent caspase upregulation may be correlated with progression of Alzheimer's disease in human patients. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit neoatal lethality likely due to respiratory distress and hydroureter and hydronephrosis associated with impaired development of ureteric smooth muscle. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931428L18Rik	T	C	1: 31,222,507		probably benign	Het
5430419D17Rik	A	T	7: 131,256,801	D1066V	probably benign	Het
6430573F11Rik	T	C	8: 36,498,483		probably null	Het
Abca9	G	A	11: 110,165,962	Q11*	probably null	Het
Abcc9	A	T	6: 142,604,895	M1273K	probably damaging	Het
Abi2	A	G	1: 60,438,939		probably null	Het
Acsm5	A	G	7: 119,534,881	E295G	probably benign	Het
Anapc5	T	C	5: 122,800,544	D389G	probably benign	Het
Ano3	A	T	2: 110,795,027	D159E	probably benign	Het
Arhgap26	T	A	18: 39,150,057	M349K	probably damaging	Het
Arhgef39	A	G	4: 43,498,580		probably null	Het
Astn1	T	C	1: 158,612,462	S867P	probably benign	Het
Atad3a	A	T	4: 155,753,641		probably null	Het
Cadm1	A	T	9: 47,788,109	D91V	probably damaging	Het
Cc2d2b	T	C	19: 40,802,395	I933T	possibly damaging	Het
Celsr3	C	G	9: 108,837,084	N1937K	possibly damaging	Het
Cic	A	C	7: 25,288,281	T558P	possibly damaging	Het
Cntln	A	G	4: 85,067,510	M933V	probably benign	Het
Coch	T	C	12: 51,598,173	F170S	probably damaging	Het
Col1a2	A	G	6: 4,538,680	Y1200C	unknown	Het
Col26a1	T	C	5: 136,744,178	M383V	probably benign	Het
Col4a4	A	T	1: 82,453,778	M1595K	unknown	Het
Crh	T	C	3: 19,694,337	E47G	probably benign	Het
Cyhr1	T	C	15: 76,658,708		probably null	Het
D930020B18Rik	T	C	10: 121,661,148		probably null	Het
Def6	G	A	17: 28,226,163	R482H	probably benign	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Dpagt1	T	C	9: 44,331,190	L241P	probably damaging	Het
E2f7	A	G	10: 110,774,681	E389G	probably damaging	Het
Eif2b1	T	C	5: 124,577,111	I53V	probably benign	Het
Fbxo4	A	G	15: 3,965,734	L376P	probably damaging	Het
Fgfr2	A	G	7: 130,185,278	S352P	possibly damaging	Het
Fkbpl	C	A	17: 34,645,414	P52Q	possibly damaging	Het
Fry	G	A	5: 150,386,014	R641H	probably damaging	Het
Fsip2	A	G	2: 82,990,086	T5388A	possibly damaging	Het
Gm12728	A	G	4: 105,794,349	K52R	probably damaging	Het
Gm8298	T	C	3: 59,861,057	Y3H	probably benign	Het
Gtf2a1l	A	G	17: 88,711,625	D379G	probably benign	Het
Gys1	A	T	7: 45,442,969	Y332F	possibly damaging	Het
Hoxa7	T	A	6: 52,216,614		probably benign	Het
Ifitm1	G	A	7: 140,969,606	V101I	probably benign	Het
Kalrn	T	A	16: 34,360,984	T95S	probably damaging	Het
Leng8	A	G	7: 4,145,413	Y728C	probably damaging	Het
Lonp2	G	T	8: 86,634,908	D238Y	possibly damaging	Het
Ltn1	A	C	16: 87,378,980	S1757A	probably damaging	Het
Man2a2	A	T	7: 80,364,071	S411T	probably damaging	Het
Mrps33	C	A	6: 39,805,370		probably null	Het
Muc16	C	T	9: 18,550,677		probably null	Het
Muc5ac	A	G	7: 141,809,071		probably benign	Het
Naip2	A	C	13: 100,162,041	S496A	probably benign	Het
Olfr1141	T	C	2: 87,753,468	N175S	probably damaging	Het
Olfr1204	A	T	2: 88,852,519	T190S	probably damaging	Het
Olfr122	T	G	17: 37,772,303	F217V	probably damaging	Het
Olfr1340	A	G	4: 118,726,733	Y162C	probably damaging	Het
Olfr50	T	A	2: 36,793,777	D180E	possibly damaging	Het
Olfr545	A	T	7: 102,494,139	V212D	probably damaging	Het
Pag1	T	A	3: 9,699,336	E252D	possibly damaging	Het
Plcd3	T	C	11: 103,077,767	Y366C	probably damaging	Het
Psg17	A	C	7: 18,814,450	S465R	probably damaging	Het
Ptpn9	G	T	9: 57,023,040	V50L	probably damaging	Het
Rab17	T	G	1: 90,958,961	S190R	probably benign	Het
Samd11	A	G	4: 156,249,078		probably null	Het
Slc17a5	A	G	9: 78,538,271	F434S	possibly damaging	Het
Slc22a15	A	G	3: 101,883,583	I202T	possibly damaging	Het
Slc8a1	G	T	17: 81,388,918	Q896K	probably benign	Het
Slc9a5	A	T	8: 105,358,393	K509*	probably null	Het
Slf2	A	C	19: 44,973,164	M1041L	probably benign	Het
Smn1	A	G	13: 100,128,500		probably null	Het
Snx9	T	C	17: 5,922,209		probably null	Het
Soat2	T	A	15: 102,162,055	L431Q	probably damaging	Het
Spam1	T	A	6: 24,796,930	N293K	probably benign	Het
Tatdn1	T	C	15: 58,923,911	T66A	possibly damaging	Het
Tmprss11g	A	T	5: 86,492,156	S205T	probably benign	Het
Tnpo3	G	T	6: 29,571,101	N431K	possibly damaging	Het
Trim39	T	C	17: 36,268,662	T31A	probably benign	Het
Ttll11	G	A	2: 35,902,754	T359M	probably damaging	Het
Ttn	T	G	2: 76,741,499	D26350A	probably damaging	Het
Ubr4	G	T	4: 139,431,751	V2472F	probably damaging	Het
Vsx2	C	T	12: 84,593,104	P265S	probably benign	Het
Wdr90	C	T	17: 25,845,911	G1708R	probably damaging	Het
Wnt11	A	G	7: 98,853,274	Y351C	probably damaging	Het
Xpo6	A	C	7: 126,112,885	N3K	probably damaging	Het
Zfp445	A	G	9: 122,857,566	S165P	probably benign	Het
Zfp953	A	T	13: 67,347,937	Y13*	probably null	Het

Other mutations in Tshz3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01875:Tshz3	APN	7	36769960	missense	probably damaging	0.97
IGL01922:Tshz3	APN	7	36769605	missense	probably damaging	1.00
IGL02047:Tshz3	APN	7	36770468	missense	probably damaging	1.00
IGL02166:Tshz3	APN	7	36768921	missense	probably benign	0.00
IGL02405:Tshz3	APN	7	36769650	missense	possibly damaging	0.93
IGL02658:Tshz3	APN	7	36769158	missense	probably damaging	0.99
IGL02968:Tshz3	APN	7	36769824	missense	probably damaging	1.00
IGL03073:Tshz3	APN	7	36770745	missense	probably damaging	1.00
IGL03233:Tshz3	APN	7	36770079	missense	probably damaging	0.97
IGL03296:Tshz3	APN	7	36771336	missense	probably damaging	1.00
R0049:Tshz3	UTSW	7	36770109	missense	probably damaging	1.00
R0049:Tshz3	UTSW	7	36770109	missense	probably damaging	1.00
R0090:Tshz3	UTSW	7	36768892	missense	probably benign
R0329:Tshz3	UTSW	7	36770033	missense	probably benign
R0330:Tshz3	UTSW	7	36770033	missense	probably benign
R0360:Tshz3	UTSW	7	36770533	missense	probably benign
R0364:Tshz3	UTSW	7	36770533	missense	probably benign
R0380:Tshz3	UTSW	7	36771300	missense	probably damaging	1.00
R0547:Tshz3	UTSW	7	36771417	missense	probably damaging	1.00
R1061:Tshz3	UTSW	7	36768706	missense	probably damaging	1.00
R1618:Tshz3	UTSW	7	36771796	missense	probably damaging	1.00
R1704:Tshz3	UTSW	7	36771360	missense	possibly damaging	0.92
R1881:Tshz3	UTSW	7	36771654	missense	possibly damaging	0.87
R1926:Tshz3	UTSW	7	36769375	missense	probably damaging	1.00
R1994:Tshz3	UTSW	7	36769822	missense	probably damaging	0.99
R2404:Tshz3	UTSW	7	36770380	missense	probably damaging	0.99
R2447:Tshz3	UTSW	7	36768753	missense	probably benign	0.00
R2930:Tshz3	UTSW	7	36771592	missense	possibly damaging	0.74
R3879:Tshz3	UTSW	7	36771537	nonsense	probably null
R4033:Tshz3	UTSW	7	36770584	missense	possibly damaging	0.71
R4212:Tshz3	UTSW	7	36770119	missense	probably damaging	1.00
R4394:Tshz3	UTSW	7	36769605	missense	probably damaging	1.00
R4779:Tshz3	UTSW	7	36768972	missense	probably damaging	1.00
R4977:Tshz3	UTSW	7	36771190	missense	probably benign	0.31
R5139:Tshz3	UTSW	7	36771025	missense	probably benign	0.23
R5448:Tshz3	UTSW	7	36771229	missense	possibly damaging	0.90
R5516:Tshz3	UTSW	7	36770350	missense	probably benign	0.03
R5760:Tshz3	UTSW	7	36771569	missense	probably damaging	1.00
R6360:Tshz3	UTSW	7	36769441	missense	probably damaging	1.00
R6535:Tshz3	UTSW	7	36768789	missense	probably damaging	1.00
R7105:Tshz3	UTSW	7	36769756	missense	probably damaging	1.00
R7133:Tshz3	UTSW	7	36770569	missense	probably benign	0.12
R7225:Tshz3	UTSW	7	36769657	missense	probably damaging	1.00
R7238:Tshz3	UTSW	7	36770097	missense	probably damaging	1.00
X0067:Tshz3	UTSW	7	36768796	missense	probably benign	0.19
X0067:Tshz3	UTSW	7	36769321	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCACAGCATTTGCCTATTG -3'
(R):5'- ATGTGCTGTTGAGAGACGAC -3'

Sequencing Primer
(F):5'- AGCACAGCATTTGCCTATTGTCTTG -3'
(R):5'- TTGAAACTCACGGGCCACTG -3'

Posted On

2018-05-21