Incidental Mutation 'R6482:Psg21'
ID 517820
Institutional Source Beutler Lab
Gene Symbol Psg21
Ensembl Gene ENSMUSG00000070796
Gene Name pregnancy-specific glycoprotein 21
Synonyms 1600026N13Rik, 1600019C01Rik, 1600025N01Rik, cea8
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.047) question?
Stock # R6482 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 18646736-18656725 bp(-) (GRCm38)
Type of Mutation splice site (6 bp from exon)
DNA Base Change (assembly) A to T at 18654739 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094793] [ENSMUST00000182128]
AlphaFold Q9DAV5
Predicted Effect probably null
Transcript: ENSMUST00000094793
SMART Domains Protein: ENSMUSP00000092387
Gene: ENSMUSG00000070796

DomainStartEndE-ValueType
IG 39 138 3.04e-3 SMART
IG 159 260 7.25e-1 SMART
IG 276 375 1.25e-4 SMART
IGc2 393 457 1.47e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000182128
SMART Domains Protein: ENSMUSP00000138173
Gene: ENSMUSG00000070796

DomainStartEndE-ValueType
IG 39 138 3.04e-3 SMART
IG 159 260 7.25e-1 SMART
IG 276 375 1.25e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182228
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182933
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadvl T C 11: 70,011,562 I415V probably benign Het
Akap8l A G 17: 32,345,396 F6L possibly damaging Het
Ano3 T A 2: 110,697,055 N603Y probably damaging Het
Casp8ap2 T C 4: 32,634,813 S116P probably damaging Het
Ccdc110 A T 8: 45,942,788 Q572L probably benign Het
Chit1 T C 1: 134,143,242 S20P probably damaging Het
Col22a1 G A 15: 71,890,489 P107L possibly damaging Het
Dpys T C 15: 39,841,973 H248R probably damaging Het
Dsg2 A T 18: 20,601,314 K783I possibly damaging Het
Efnb2 A T 8: 8,620,637 V321E probably damaging Het
Fbxo11 A T 17: 88,012,658 Y209N probably benign Het
Gm21936 A G 12: 87,795,795 Y95C probably damaging Het
Gm35315 A T 5: 110,078,089 C495S possibly damaging Het
Hrh1 A G 6: 114,480,763 Q335R possibly damaging Het
Il12rb2 A G 6: 67,356,686 L203P probably damaging Het
Itgav T C 2: 83,794,270 S735P probably damaging Het
Klrg1 G T 6: 122,271,453 C162* probably null Het
Mcc T C 18: 44,445,864 S651G possibly damaging Het
Nkx2-2 T A 2: 147,185,976 I15F probably damaging Het
Nppa G A 4: 148,000,871 V13I probably benign Het
Olfr1104 G C 2: 87,022,525 F6L probably benign Het
Pde2a A G 7: 101,501,037 N228D probably benign Het
Pgpep1l C T 7: 68,239,067 probably null Het
Plekhg3 A G 12: 76,576,004 N673D probably benign Het
Plxna4 A G 6: 32,516,737 S315P probably benign Het
Rnf111 T C 9: 70,429,607 T925A probably damaging Het
Rnf219 A T 14: 104,479,817 C373* probably null Het
Spag9 T C 11: 94,093,502 F734L possibly damaging Het
Tarbp1 A G 8: 126,450,695 V746A probably benign Het
Tmtc1 A G 6: 148,412,745 F119L probably benign Het
Ttc21b A G 2: 66,226,900 M576T probably benign Het
Usp48 T A 4: 137,634,921 V765E probably damaging Het
Vmn1r20 A G 6: 57,432,108 S140G probably benign Het
Vwde A G 6: 13,205,844 S235P probably damaging Het
Wapl A G 14: 34,692,692 S504G probably benign Het
Wnt5b A T 6: 119,433,612 L289Q possibly damaging Het
Zfp142 G A 1: 74,570,217 probably null Het
Zfp385b ATCTTCTTCTTCT ATCTTCTTCTTCTTCT 2: 77,719,648 probably benign Het
Zfp948 A G 17: 21,587,551 H335R probably benign Het
Other mutations in Psg21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01571:Psg21 APN 7 18654825 missense probably damaging 1.00
IGL02390:Psg21 APN 7 18652631 missense probably benign 0.11
IGL02548:Psg21 APN 7 18655036 missense possibly damaging 0.89
IGL03001:Psg21 APN 7 18652485 missense probably benign 0.03
IGL03135:Psg21 APN 7 18654918 missense probably benign 0.00
R0131:Psg21 UTSW 7 18654868 missense probably benign 0.39
R0551:Psg21 UTSW 7 18652640 critical splice acceptor site probably null
R1512:Psg21 UTSW 7 18656500 missense probably benign 0.00
R1874:Psg21 UTSW 7 18650816 missense probably benign 0.15
R1993:Psg21 UTSW 7 18654770 missense probably benign 0.04
R2327:Psg21 UTSW 7 18652453 missense possibly damaging 0.61
R3414:Psg21 UTSW 7 18652380 missense probably damaging 1.00
R4422:Psg21 UTSW 7 18647332 missense probably damaging 1.00
R5138:Psg21 UTSW 7 18656528 start codon destroyed probably null 0.94
R5623:Psg21 UTSW 7 18655014 missense probably damaging 1.00
R5686:Psg21 UTSW 7 18652258 intron probably benign
R6166:Psg21 UTSW 7 18656739 unclassified probably benign
R6177:Psg21 UTSW 7 18652354 missense possibly damaging 0.64
R6190:Psg21 UTSW 7 18655001 missense possibly damaging 0.61
R6210:Psg21 UTSW 7 18652345 missense probably damaging 1.00
R6729:Psg21 UTSW 7 18652591 missense probably damaging 1.00
R6866:Psg21 UTSW 7 18652284 missense probably damaging 1.00
R6992:Psg21 UTSW 7 18654743 critical splice donor site probably null
R7075:Psg21 UTSW 7 18654861 missense probably damaging 1.00
R7081:Psg21 UTSW 7 18654849 nonsense probably null
R7098:Psg21 UTSW 7 18652545 missense probably damaging 1.00
R7582:Psg21 UTSW 7 18647203 makesense probably null
R7588:Psg21 UTSW 7 18647209 missense probably benign 0.00
R7607:Psg21 UTSW 7 18654783 missense probably benign 0.02
R7830:Psg21 UTSW 7 18647298 missense probably damaging 1.00
R7964:Psg21 UTSW 7 18647211 missense probably benign 0.01
R8758:Psg21 UTSW 7 18650753 missense probably damaging 1.00
R8972:Psg21 UTSW 7 18647368 missense probably benign 0.03
R8988:Psg21 UTSW 7 18652464 missense probably benign 0.00
R9119:Psg21 UTSW 7 18647484 missense probably benign 0.14
R9446:Psg21 UTSW 7 18654940 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGACAGAGGCTGATGTCCTTG -3'
(R):5'- CAAGTATGACAGGGCCTGAG -3'

Sequencing Primer
(F):5'- TGGAATCAAATGAGGGATTCTGCAC -3'
(R):5'- GGCCTGAGCACAGTGATAG -3'
Posted On 2018-05-21