Incidental Mutation 'R6482:Pgpep1l'
ID 517821
Institutional Source Beutler Lab
Gene Symbol Pgpep1l
Ensembl Gene ENSMUSG00000030553
Gene Name pyroglutamyl-peptidase I-like
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock # R6482 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 68236610-68264233 bp(-) (GRCm38)
Type of Mutation splice site (5 bp from exon)
DNA Base Change (assembly) C to T at 68239067 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032770] [ENSMUST00000207874]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000032770
SMART Domains Protein: ENSMUSP00000032770
Gene: ENSMUSG00000030553

DomainStartEndE-ValueType
Pfam:Peptidase_C15 5 111 8.5e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000207874
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadvl T C 11: 70,011,562 I415V probably benign Het
Akap8l A G 17: 32,345,396 F6L possibly damaging Het
Ano3 T A 2: 110,697,055 N603Y probably damaging Het
Casp8ap2 T C 4: 32,634,813 S116P probably damaging Het
Ccdc110 A T 8: 45,942,788 Q572L probably benign Het
Chit1 T C 1: 134,143,242 S20P probably damaging Het
Col22a1 G A 15: 71,890,489 P107L possibly damaging Het
Dpys T C 15: 39,841,973 H248R probably damaging Het
Dsg2 A T 18: 20,601,314 K783I possibly damaging Het
Efnb2 A T 8: 8,620,637 V321E probably damaging Het
Fbxo11 A T 17: 88,012,658 Y209N probably benign Het
Gm21936 A G 12: 87,795,795 Y95C probably damaging Het
Gm35315 A T 5: 110,078,089 C495S possibly damaging Het
Hrh1 A G 6: 114,480,763 Q335R possibly damaging Het
Il12rb2 A G 6: 67,356,686 L203P probably damaging Het
Itgav T C 2: 83,794,270 S735P probably damaging Het
Klrg1 G T 6: 122,271,453 C162* probably null Het
Mcc T C 18: 44,445,864 S651G possibly damaging Het
Nkx2-2 T A 2: 147,185,976 I15F probably damaging Het
Nppa G A 4: 148,000,871 V13I probably benign Het
Olfr1104 G C 2: 87,022,525 F6L probably benign Het
Pde2a A G 7: 101,501,037 N228D probably benign Het
Plekhg3 A G 12: 76,576,004 N673D probably benign Het
Plxna4 A G 6: 32,516,737 S315P probably benign Het
Psg21 A T 7: 18,654,739 probably null Het
Rnf111 T C 9: 70,429,607 T925A probably damaging Het
Rnf219 A T 14: 104,479,817 C373* probably null Het
Spag9 T C 11: 94,093,502 F734L possibly damaging Het
Tarbp1 A G 8: 126,450,695 V746A probably benign Het
Tmtc1 A G 6: 148,412,745 F119L probably benign Het
Ttc21b A G 2: 66,226,900 M576T probably benign Het
Usp48 T A 4: 137,634,921 V765E probably damaging Het
Vmn1r20 A G 6: 57,432,108 S140G probably benign Het
Vwde A G 6: 13,205,844 S235P probably damaging Het
Wapl A G 14: 34,692,692 S504G probably benign Het
Wnt5b A T 6: 119,433,612 L289Q possibly damaging Het
Zfp142 G A 1: 74,570,217 probably null Het
Zfp385b ATCTTCTTCTTCT ATCTTCTTCTTCTTCT 2: 77,719,648 probably benign Het
Zfp948 A G 17: 21,587,551 H335R probably benign Het
Other mutations in Pgpep1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01522:Pgpep1l APN 7 68237708 missense possibly damaging 0.62
IGL02735:Pgpep1l APN 7 68236973 missense probably benign 0.00
R1742:Pgpep1l UTSW 7 68237054 missense probably damaging 1.00
R4232:Pgpep1l UTSW 7 68237079 missense probably benign 0.04
R7343:Pgpep1l UTSW 7 68237721 missense probably damaging 1.00
R7883:Pgpep1l UTSW 7 68239149 nonsense probably null
R8084:Pgpep1l UTSW 7 68237771 missense probably benign 0.41
R9005:Pgpep1l UTSW 7 68237658 missense probably damaging 1.00
X0012:Pgpep1l UTSW 7 68237646 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATTCCCATTTTGTCCGGC -3'
(R):5'- CATACAGTCTTGGGTGCCTTTG -3'

Sequencing Primer
(F):5'- ATTTTGTCCGGCCCACTTG -3'
(R):5'- GTGCCTTTGTGTCCAGGCAAC -3'
Posted On 2018-05-21