Incidental Mutation 'R6483:Col1a1'
ID517822
Institutional Source Beutler Lab
Gene Symbol Col1a1
Ensembl Gene ENSMUSG00000001506
Gene Namecollagen, type I, alpha 1
SynonymsCola1, Mov-13, Col1a-1, Cola-1
MMRRC Submission
Accession Numbers

MGI: 88467

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6483 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location94936224-94953042 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 94942618 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000001547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001547]
Predicted Effect probably null
Transcript: ENSMUST00000001547
SMART Domains Protein: ENSMUSP00000001547
Gene: ENSMUSG00000001506

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWC 31 86 1.04e-16 SMART
Pfam:Collagen 97 154 1.1e-9 PFAM
Pfam:Collagen 166 227 7e-10 PFAM
Pfam:Collagen 225 284 2.4e-13 PFAM
Pfam:Collagen 285 344 5.9e-12 PFAM
low complexity region 354 426 N/A INTRINSIC
internal_repeat_4 427 444 4.93e-7 PROSPERO
low complexity region 447 486 N/A INTRINSIC
low complexity region 495 516 N/A INTRINSIC
low complexity region 527 567 N/A INTRINSIC
internal_repeat_3 570 588 1.25e-9 PROSPERO
low complexity region 590 600 N/A INTRINSIC
low complexity region 603 627 N/A INTRINSIC
low complexity region 629 651 N/A INTRINSIC
internal_repeat_1 652 675 6.29e-11 PROSPERO
internal_repeat_4 658 675 4.93e-7 PROSPERO
low complexity region 678 699 N/A INTRINSIC
low complexity region 702 717 N/A INTRINSIC
internal_repeat_2 718 738 2.08e-10 PROSPERO
internal_repeat_1 718 741 6.29e-11 PROSPERO
internal_repeat_3 726 744 1.25e-9 PROSPERO
internal_repeat_5 737 752 9.8e-6 PROSPERO
Pfam:Collagen 768 827 2.8e-12 PFAM
Pfam:Collagen 828 887 6.8e-11 PFAM
internal_repeat_5 944 959 9.8e-6 PROSPERO
internal_repeat_2 952 972 2.08e-10 PROSPERO
Pfam:Collagen 1008 1077 4.8e-8 PFAM
Pfam:Collagen 1068 1127 1.2e-12 PFAM
Pfam:Collagen 1122 1184 2.8e-9 PFAM
PDB:3HR2|C 1185 1205 6e-6 PDB
COLFI 1217 1453 2.04e-162 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148046
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148593
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of the fibril-forming type I collagen, the most abundant protein of bone, skin and tendon extracellular matrices. The encoded protein, in association with alpha-2 subunit, forms heterotrimeric type I procollagen that undergoes proteolytic processing during fibril formation. Mice lacking the encoded protein die in utero caused by the rupture of a major blood vessel. Transgenic mice expressing significantly lower levels of this gene exhibit morphological and functional defects in mineralized and non-mineralized connective tissue and, progressive loss of hearing. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutations in this locus cause variable phenotype, from embryonic lethal to viable/fertile with altered fibrillogenesis. Homozygotes can show impaired bone formation and fragility, osteoporosis, dermal fibrosis, impaired uterine postpartum involution, andaortic dissection. [provided by MGI curators]
Allele List at MGI

All alleles(46) : Targeted(40) Gene trapped(3) Transgenic(1) Chemically induced(2)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T G 14: 29,978,581 L39R possibly damaging Het
Amer3 T C 1: 34,587,690 S337P probably damaging Het
Arhgef10l A T 4: 140,616,915 I12K probably damaging Het
Atp2b4 A G 1: 133,729,880 V624A possibly damaging Het
BB014433 A T 8: 15,042,208 L215Q probably benign Het
Bod1l A G 5: 41,821,082 V963A probably benign Het
Bpifa6 T C 2: 153,990,434 L287S probably benign Het
Bsnd A T 4: 106,488,015 L78Q probably damaging Het
C1qtnf3 T C 15: 10,958,070 probably null Het
Ccdc180 T G 4: 45,921,950 V1008G probably benign Het
Ccl1 T G 11: 82,178,034 D59A possibly damaging Het
Cfap58 T C 19: 47,983,452 I607T probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cntnap4 C T 8: 112,757,473 P386L possibly damaging Het
Dnajc13 A T 9: 104,207,804 D798E probably damaging Het
Eml6 T G 11: 29,749,875 I1754L probably benign Het
Ercc8 T A 13: 108,183,810 V310D probably damaging Het
Fat2 G A 11: 55,296,345 T1225I probably damaging Het
Gba A G 3: 89,208,603 Y510C probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm43302 T A 5: 105,275,860 M416L probably benign Het
Grxcr2 A T 18: 41,991,890 V151E probably benign Het
Gtf2ird2 A G 5: 134,211,225 N296S probably benign Het
Herc1 T A 9: 66,448,529 I2354N possibly damaging Het
Inhbc G A 10: 127,357,440 R236* probably null Het
Itpr2 T C 6: 146,112,477 D2607G possibly damaging Het
Kcnh7 T A 2: 62,845,774 D298V probably benign Het
Klrb1c A G 6: 128,784,185 S160P probably benign Het
Mrgpra2a C G 7: 47,426,689 E274Q probably benign Het
Muc5ac T A 7: 141,802,854 F1059L probably benign Het
Naglu T C 11: 101,071,181 I160T probably damaging Het
Nasp A T 4: 116,618,948 L47Q probably damaging Het
Olfr1037 C A 2: 86,085,440 M112I probably benign Het
Olfr519 C T 7: 108,894,111 V99M possibly damaging Het
Olfr686 T C 7: 105,204,293 T17A probably benign Het
Opa1 C T 16: 29,628,707 T873I possibly damaging Het
Pttg1 A G 11: 43,424,844 F48L probably damaging Het
Rho T C 6: 115,932,257 F85L possibly damaging Het
Rnasel T C 1: 153,754,686 V316A probably benign Het
Slc36a3 A G 11: 55,135,263 I243T probably benign Het
Tada2b G A 5: 36,476,685 T183M possibly damaging Het
Tbc1d22a A G 15: 86,301,567 M286V possibly damaging Het
Trim69 G T 2: 122,167,600 E18* probably null Het
Ttn T C 2: 76,942,050 T2503A possibly damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Zfp654 T A 16: 64,791,947 N192I possibly damaging Het
Zfp809 G A 9: 22,236,244 R58H probably benign Het
Other mutations in Col1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Col1a1 APN 11 94949378 missense unknown
IGL01383:Col1a1 APN 11 94945525 missense probably damaging 1.00
IGL01717:Col1a1 APN 11 94950777 missense unknown
IGL02889:Col1a1 APN 11 94951509 missense unknown
seal UTSW 11 94947184 splice site probably benign
walrus UTSW 11 94942385 missense unknown
R0121:Col1a1 UTSW 11 94938069 missense unknown
R0400:Col1a1 UTSW 11 94941369 splice site probably benign
R0545:Col1a1 UTSW 11 94951594 missense unknown
R0661:Col1a1 UTSW 11 94949389 missense unknown
R1220:Col1a1 UTSW 11 94951131 missense unknown
R1717:Col1a1 UTSW 11 94948392 missense unknown
R1732:Col1a1 UTSW 11 94944415 splice site probably benign
R1879:Col1a1 UTSW 11 94951225 missense unknown
R1880:Col1a1 UTSW 11 94950568 missense unknown
R1901:Col1a1 UTSW 11 94946632 splice site probably null
R2113:Col1a1 UTSW 11 94948362 missense unknown
R2386:Col1a1 UTSW 11 94950391 missense unknown
R3803:Col1a1 UTSW 11 94938069 missense unknown
R4839:Col1a1 UTSW 11 94950095 critical splice acceptor site probably null
R4936:Col1a1 UTSW 11 94947132 missense unknown
R5081:Col1a1 UTSW 11 94951576 missense unknown
R5105:Col1a1 UTSW 11 94942385 missense unknown
R5110:Col1a1 UTSW 11 94941593 critical splice donor site probably null
R5247:Col1a1 UTSW 11 94947187 splice site probably null
R5773:Col1a1 UTSW 11 94939429 missense probably benign 0.10
R5776:Col1a1 UTSW 11 94949724 missense unknown
R5991:Col1a1 UTSW 11 94937919 missense unknown
R6415:Col1a1 UTSW 11 94940160 missense unknown
R7207:Col1a1 UTSW 11 94938526 missense unknown
R7853:Col1a1 UTSW 11 94947679 missense unknown
R7936:Col1a1 UTSW 11 94947679 missense unknown
RF007:Col1a1 UTSW 11 94943040 missense probably damaging 1.00
Z1177:Col1a1 UTSW 11 94943804 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- AAATGTCTGTCCTGACTCCTGC -3'
(R):5'- TTGAACTCCAGTAGCACCCTG -3'

Sequencing Primer
(F):5'- TCCAGGTCCCAAGGGTAACAG -3'
(R):5'- AGTAGCACCCTGGAGTGG -3'
Posted On2018-05-21