Incidental Mutation 'R6485:Pgd'
ID517824
Institutional Source Beutler Lab
Gene Symbol Pgd
Ensembl Gene ENSMUSG00000028961
Gene Namephosphogluconate dehydrogenase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R6485 (G1)
Quality Score106.008
Status Not validated
Chromosome4
Chromosomal Location149149991-149166771 bp(-) (GRCm38)
Type of Mutationsplice site (188 bp from exon)
DNA Base Change (assembly) A to T at 149156419 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000081141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084124]
Predicted Effect probably null
Transcript: ENSMUST00000084124
SMART Domains Protein: ENSMUSP00000081141
Gene: ENSMUSG00000028961

DomainStartEndE-ValueType
Pfam:NAD_binding_2 3 176 3.2e-52 PFAM
6PGD 180 470 7.75e-219 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124409
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137982
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156120
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] 6-phosphogluconate dehydrogenase is the second dehydrogenase in the pentose phosphate shunt. Deficiency of this enzyme is generally asymptomatic, and the inheritance of this disorder is autosomal dominant. Hemolysis results from combined deficiency of 6-phosphogluconate dehydrogenase and 6-phosphogluconolactonase suggesting a synergism of the two enzymopathies. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 C A 7: 120,427,167 Y117* probably null Het
Acot5 A T 12: 84,075,484 R281W probably damaging Het
Adamts20 T C 15: 94,343,971 T719A probably benign Het
Arhgap33 T C 7: 30,524,004 T867A probably benign Het
Bcl2a1c T C 9: 114,330,210 Y19H probably benign Het
Bod1l A G 5: 41,817,116 I2285T possibly damaging Het
Cacna2d1 A G 5: 16,354,657 Y755C probably damaging Het
Cdc27 T C 11: 104,505,648 T816A probably benign Het
Clasrp C A 7: 19,586,369 probably benign Het
Col6a4 A G 9: 106,076,870 probably null Het
Cpd T C 11: 76,808,707 probably null Het
Crispld2 A G 8: 120,029,309 D339G probably damaging Het
Dst A G 1: 34,294,529 D7046G probably damaging Het
Erbin G T 13: 103,868,113 Q136K probably damaging Het
Exph5 G A 9: 53,376,691 E1691K possibly damaging Het
Fads6 A G 11: 115,285,438 F187S probably benign Het
Foxg1 A T 12: 49,385,080 I199F probably damaging Het
Garem1 T C 18: 21,129,837 D640G probably benign Het
Gba2 A C 4: 43,574,118 Y112D probably damaging Het
Gcfc2 T C 6: 81,939,547 I323T probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gria4 T A 9: 4,464,249 Y571F probably damaging Het
Large2 T C 2: 92,366,028 T485A probably benign Het
Lonrf1 A G 8: 36,229,134 probably null Het
Mrgprb5 T C 7: 48,168,777 N70S probably damaging Het
Muc2 T A 7: 141,746,736 probably benign Het
Nol4 T C 18: 22,770,793 D375G probably damaging Het
Olfr1359 A G 13: 21,703,430 Q143R probably benign Het
Pcnt G T 10: 76,389,330 S1780* probably null Het
Pdgfra A T 5: 75,175,074 probably null Het
Pla2g6 T C 15: 79,307,372 I279V probably benign Het
Ptpn21 A T 12: 98,698,872 C297* probably null Het
Ripply1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT TTCCTCCTCCTCCTCCTCCTCCTCCTCCT X: 139,779,850 probably benign Het
Rtcb T C 10: 85,957,644 I22V probably benign Het
Slc25a30 G T 14: 75,775,007 A67E probably damaging Het
Stk11ip T C 1: 75,529,968 V605A possibly damaging Het
Ush1c A T 7: 46,209,110 S585T probably benign Het
Vps13a T C 19: 16,680,050 D1785G probably damaging Het
Zic5 T A 14: 122,459,640 Y521F unknown Het
Other mutations in Pgd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02173:Pgd APN 4 149156753 missense probably damaging 1.00
IGL02480:Pgd APN 4 149156618 missense probably damaging 1.00
IGL03028:Pgd APN 4 149161627 critical splice donor site probably null
IGL03370:Pgd APN 4 149165228 missense probably damaging 1.00
R0398:Pgd UTSW 4 149153882 missense probably damaging 1.00
R0601:Pgd UTSW 4 149156810 splice site probably benign
R0980:Pgd UTSW 4 149154311 splice site probably null
R1475:Pgd UTSW 4 149156775 missense probably benign 0.00
R3826:Pgd UTSW 4 149166004 splice site probably benign
R4531:Pgd UTSW 4 149156777 missense probably benign 0.01
R4832:Pgd UTSW 4 149156591 intron probably benign
R6352:Pgd UTSW 4 149160752 splice site probably null
R6353:Pgd UTSW 4 149160752 splice site probably null
R6514:Pgd UTSW 4 149160752 splice site probably null
R6519:Pgd UTSW 4 149150886 nonsense probably null
R6543:Pgd UTSW 4 149160752 splice site probably null
R7153:Pgd UTSW 4 149161678 missense probably benign
Z1176:Pgd UTSW 4 149166679 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TCCAAACCCAGAGAATTCATGTTG -3'
(R):5'- GGTAATATGGCAGCTTTCCCC -3'

Sequencing Primer
(F):5'- CCCAGAGAATTCATGTTGACTACTAC -3'
(R):5'- AATATGGCAGCTTTCCCCTTCTTTG -3'
Posted On2018-05-21