Incidental Mutation 'R6458:Nckap1'
ID517831
Institutional Source Beutler Lab
Gene Symbol Nckap1
Ensembl Gene ENSMUSG00000027002
Gene NameNCK-associated protein 1
Synonymsmh19, Hem-2, Nap1, Hem2, H19
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6458 (G1)
Quality Score134.008
Status Validated
Chromosome2
Chromosomal Location80500512-80581380 bp(-) (GRCm38)
Type of Mutationsplice site (128 bp from exon)
DNA Base Change (assembly) T to C at 80512549 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028386] [ENSMUST00000111760]
Predicted Effect probably null
Transcript: ENSMUST00000028386
SMART Domains Protein: ENSMUSP00000028386
Gene: ENSMUSG00000027002

DomainStartEndE-ValueType
Pfam:Nckap1 8 1124 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000111760
SMART Domains Protein: ENSMUSP00000107390
Gene: ENSMUSG00000027002

DomainStartEndE-ValueType
Pfam:Nckap1 9 1128 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154793
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.3%
Validation Efficiency 100% (56/56)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene exhibit growth arrest at midgestation, an open neural tube, cardia bifida, defective foregut development, defects in endoderm and mesoderm migration and sometimes duplication of the anteroposterior body axis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot8 A G 2: 164,804,735 V28A possibly damaging Het
Ak1 T A 2: 32,630,373 M61K probably damaging Het
Akap12 T C 10: 4,355,148 S653P probably damaging Het
Anapc4 G A 5: 52,864,553 R659H possibly damaging Het
Arel1 T C 12: 84,940,385 N86D possibly damaging Het
BC005561 A T 5: 104,522,303 I1564L probably benign Het
Bco1 A G 8: 117,127,506 D390G possibly damaging Het
Ccr1l1 A T 9: 123,978,166 D81E probably damaging Het
Chd1 A T 17: 15,730,602 N185I probably benign Het
Clca4b T G 3: 144,911,327 N854T possibly damaging Het
Col4a4 T C 1: 82,455,825 T1466A unknown Het
Cxcr4 T C 1: 128,589,094 I277V probably benign Het
Dgkq A G 5: 108,654,376 V441A possibly damaging Het
Dnah10 G T 5: 124,809,269 L3030F probably damaging Het
Epg5 T A 18: 77,948,254 D55E probably benign Het
Ermap A T 4: 119,178,140 N550K probably damaging Het
Fnbp1l A T 3: 122,556,440 I374N probably damaging Het
Gadl1 T A 9: 116,041,002 *479K probably null Het
Gm5591 T A 7: 38,519,035 T805S probably damaging Het
H2-T3 A T 17: 36,187,019 M334K possibly damaging Het
Ihh C T 1: 74,946,442 A295T probably damaging Het
Il18r1 T A 1: 40,491,182 Y356* probably null Het
Lingo3 A G 10: 80,835,316 V260A probably damaging Het
Lrp2 T G 2: 69,505,156 M1408L probably benign Het
Mical1 C A 10: 41,484,735 H657N probably benign Het
Mpp2 T A 11: 102,080,769 M12L probably benign Het
Muc16 A T 9: 18,641,721 D4425E probably benign Het
Muc4 T A 16: 32,759,320 probably null Het
Myt1l T A 12: 29,895,299 F1021Y unknown Het
Nbas T C 12: 13,288,749 S197P probably damaging Het
Nek1 T G 8: 61,100,012 V903G probably benign Het
Olfr1184 T A 2: 88,487,218 I162N possibly damaging Het
Olfr299 A G 7: 86,465,680 I90V probably damaging Het
Olfr377-ps1 T G 11: 73,388,691 S112R probably damaging Het
Olfr889 T C 9: 38,116,054 V91A possibly damaging Het
Ppm1j T C 3: 104,781,244 V53A probably benign Het
Ralgapb T A 2: 158,444,620 D328E probably damaging Het
Rgma T A 7: 73,409,694 V88E probably damaging Het
Slc30a6 A G 17: 74,423,113 T333A probably damaging Het
Spr T C 6: 85,137,057 probably null Het
Srek1 A T 13: 103,743,568 V494E probably benign Het
Ston1 A T 17: 88,635,303 T46S probably benign Het
Stox2 T C 8: 47,192,044 K858E possibly damaging Het
Thoc1 G A 18: 9,993,333 R564Q probably benign Het
Tmc5 T A 7: 118,645,316 N472K probably damaging Het
Ttc41 A G 10: 86,758,270 T856A possibly damaging Het
Ttn A T 2: 76,778,510 W17721R probably damaging Het
Vmn1r69 A G 7: 10,580,438 I43T probably benign Het
Vmn2r56 T A 7: 12,694,057 I761F probably damaging Het
Zfp109 T C 7: 24,228,445 D521G probably benign Het
Zfp516 A G 18: 82,987,350 H793R probably benign Het
Zfp800 A T 6: 28,244,216 I250N probably damaging Het
Zpbp T A 11: 11,408,538 Y243F probably damaging Het
Other mutations in Nckap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Nckap1 APN 2 80506202 missense possibly damaging 0.87
IGL00896:Nckap1 APN 2 80580953 missense possibly damaging 0.59
IGL01343:Nckap1 APN 2 80519842 missense possibly damaging 0.81
IGL01593:Nckap1 APN 2 80520570 missense probably benign 0.06
IGL01677:Nckap1 APN 2 80530297 missense probably benign 0.04
IGL01873:Nckap1 APN 2 80553385 missense possibly damaging 0.95
IGL01874:Nckap1 APN 2 80525636 missense probably damaging 1.00
IGL01947:Nckap1 APN 2 80508753 missense probably damaging 1.00
IGL02268:Nckap1 APN 2 80528618 missense probably benign 0.16
IGL02348:Nckap1 APN 2 80517982 missense probably damaging 1.00
IGL03349:Nckap1 APN 2 80525560 missense probably benign 0.07
PIT4151001:Nckap1 UTSW 2 80520370 critical splice donor site probably null
R0326:Nckap1 UTSW 2 80553370 missense probably benign 0.41
R0345:Nckap1 UTSW 2 80544977 splice site probably benign
R0520:Nckap1 UTSW 2 80541530 splice site probably benign
R0603:Nckap1 UTSW 2 80512729 missense probably benign 0.19
R0924:Nckap1 UTSW 2 80554249 missense probably benign 0.34
R0930:Nckap1 UTSW 2 80554249 missense probably benign 0.34
R0964:Nckap1 UTSW 2 80547899 critical splice donor site probably null
R1122:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1123:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1124:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1125:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1127:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1182:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1234:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1236:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1384:Nckap1 UTSW 2 80533670 missense possibly damaging 0.90
R1402:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1402:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1511:Nckap1 UTSW 2 80553415 missense probably damaging 0.99
R1677:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1686:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1687:Nckap1 UTSW 2 80520585 missense probably damaging 0.96
R1717:Nckap1 UTSW 2 80512670 splice site probably benign
R1789:Nckap1 UTSW 2 80520556 missense probably benign 0.44
R1822:Nckap1 UTSW 2 80517898 missense possibly damaging 0.58
R1840:Nckap1 UTSW 2 80502250 missense possibly damaging 0.88
R1926:Nckap1 UTSW 2 80506838 missense probably damaging 1.00
R1968:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1970:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R2027:Nckap1 UTSW 2 80535518 missense probably damaging 1.00
R2063:Nckap1 UTSW 2 80570150 missense probably damaging 1.00
R2504:Nckap1 UTSW 2 80530218 missense probably benign 0.40
R3824:Nckap1 UTSW 2 80540560 missense possibly damaging 0.72
R4784:Nckap1 UTSW 2 80506934 missense probably benign 0.15
R4908:Nckap1 UTSW 2 80523374 critical splice donor site probably null
R5077:Nckap1 UTSW 2 80548933 missense probably damaging 0.99
R5311:Nckap1 UTSW 2 80540122 missense probably damaging 1.00
R5439:Nckap1 UTSW 2 80512690 missense possibly damaging 0.81
R6141:Nckap1 UTSW 2 80530207 missense probably damaging 1.00
R6209:Nckap1 UTSW 2 80525602 missense probably damaging 1.00
R6226:Nckap1 UTSW 2 80508781 missense possibly damaging 0.96
R6294:Nckap1 UTSW 2 80541514 missense probably benign 0.03
R6937:Nckap1 UTSW 2 80508716 missense probably damaging 1.00
R6986:Nckap1 UTSW 2 80520567 missense probably benign 0.03
R7180:Nckap1 UTSW 2 80506892 missense probably benign 0.01
R7208:Nckap1 UTSW 2 80540198 missense probably benign 0.24
R7363:Nckap1 UTSW 2 80540168 missense probably damaging 1.00
R7448:Nckap1 UTSW 2 80524541 missense probably damaging 1.00
R7513:Nckap1 UTSW 2 80502291 missense possibly damaging 0.81
R7806:Nckap1 UTSW 2 80541499 missense probably damaging 0.98
R8143:Nckap1 UTSW 2 80506186 missense possibly damaging 0.93
R8270:Nckap1 UTSW 2 80524664 missense possibly damaging 0.82
Z1176:Nckap1 UTSW 2 80540508 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCTAACTTTGAATAGACCATAGCCATC -3'
(R):5'- CCTCGTGAGCTCCATTGAAGATTTC -3'

Sequencing Primer
(F):5'- TGAATAGACCATAGCCATCTTTTAAG -3'
(R):5'- GATTTCAAGGATCACATTCCTCGGG -3'
Posted On2018-05-21