Incidental Mutation 'R6459:Mrps28'
ID517833
Institutional Source Beutler Lab
Gene Symbol Mrps28
Ensembl Gene ENSMUSG00000040269
Gene Namemitochondrial ribosomal protein S28
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.507) question?
Stock #R6459 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location8802146-8923918 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to G at 8899980 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000038305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042148]
Predicted Effect probably null
Transcript: ENSMUST00000042148
SMART Domains Protein: ENSMUSP00000038305
Gene: ENSMUSG00000040269

DomainStartEndE-ValueType
S1 94 158 1.69e0 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that has been called mitochondrial ribosomal protein S35 in the literature. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr C A 11: 76,424,989 R583L probably damaging Het
Acss1 A G 2: 150,667,920 I93T probably damaging Het
Ank3 C T 10: 69,991,747 probably benign Het
Aoah A G 13: 20,999,942 Y392C probably damaging Het
Atl3 A T 19: 7,520,798 E186D probably benign Het
Atp4a A G 7: 30,712,462 K41E probably benign Het
Atp9a G A 2: 168,668,013 P500L probably damaging Het
Ccdc88b A T 19: 6,854,878 V363D possibly damaging Het
Cftr T C 6: 18,258,236 V532A probably damaging Het
Cldn13 T C 5: 134,914,915 T139A possibly damaging Het
Cnksr3 T C 10: 7,126,820 Y124C probably benign Het
Cyb5r2 T C 7: 107,753,255 K161E possibly damaging Het
Epop T C 11: 97,628,507 S259G possibly damaging Het
Fhl2 G A 1: 43,123,653 T234I possibly damaging Het
Fnip2 T C 3: 79,481,634 T567A possibly damaging Het
Frmd4b A G 6: 97,487,640 C39R probably damaging Het
Grhl3 T C 4: 135,557,433 N116S possibly damaging Het
Igkv14-111 A T 6: 68,256,741 R75S probably benign Het
Il16 A T 7: 83,722,321 D92E probably damaging Het
Il16 C A 7: 83,722,328 G90V probably damaging Het
Ipo11 T C 13: 106,865,769 probably null Het
Kng2 A G 16: 23,012,115 I148T probably damaging Het
Lrrc41 T C 4: 116,088,780 S231P possibly damaging Het
Maneal C T 4: 124,856,842 V374I possibly damaging Het
Mgat4c T A 10: 102,385,127 L90Q probably damaging Het
Ncapd3 A G 9: 27,051,755 D452G probably benign Het
Nefh T C 11: 4,939,551 T1023A unknown Het
Nipa1 A G 7: 55,979,606 V253A probably benign Het
Olfr1028 G T 2: 85,951,518 G152C probably damaging Het
Olfr1447 G T 19: 12,901,005 F258L possibly damaging Het
Olfr199 C T 16: 59,216,020 V198M probably benign Het
Olfr228 T A 2: 86,483,229 H171L probably benign Het
Olfr930 A G 9: 38,930,665 S165G probably benign Het
Pak1 A G 7: 97,907,881 D495G probably benign Het
Pcm1 G A 8: 41,261,036 R213H probably damaging Het
Prg4 T C 1: 150,454,301 probably benign Het
Proser1 C T 3: 53,478,329 T544M possibly damaging Het
Rftn1 T C 17: 50,047,306 M343V probably benign Het
Ryr1 T C 7: 29,015,654 I4656V probably benign Het
Scg2 T A 1: 79,436,290 N239Y probably damaging Het
Sec16a C A 2: 26,423,500 M1949I probably benign Het
Sipa1l2 A G 8: 125,444,484 probably null Het
Slc10a2 A C 8: 5,098,581 probably null Het
Slc25a16 C T 10: 62,937,477 Q164* probably null Het
Specc1l T C 10: 75,246,167 Y483H probably damaging Het
Ston1 T C 17: 88,636,468 V434A probably benign Het
Tarbp2 A G 15: 102,518,479 probably benign Het
Trappc8 C T 18: 20,836,868 V1022M probably benign Het
Tsen54 T C 11: 115,821,680 V269A probably damaging Het
Vps13a A T 19: 16,664,018 M78K possibly damaging Het
Vwa5b2 A G 16: 20,594,679 T215A probably damaging Het
Zc3h7a A G 16: 11,153,161 Y335H probably damaging Het
Zfp994 T A 17: 22,200,546 Q474L possibly damaging Het
Other mutations in Mrps28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01604:Mrps28 APN 3 8900070 missense probably damaging 1.00
IGL01895:Mrps28 APN 3 8900059 missense probably damaging 1.00
R1423:Mrps28 UTSW 3 8900124 missense probably benign 0.00
R1462:Mrps28 UTSW 3 8900124 missense possibly damaging 0.50
R1462:Mrps28 UTSW 3 8900124 missense possibly damaging 0.50
R3034:Mrps28 UTSW 3 8923615 missense probably benign 0.03
R4917:Mrps28 UTSW 3 8882554 intron probably benign
R4918:Mrps28 UTSW 3 8882554 intron probably benign
R5119:Mrps28 UTSW 3 8923696 missense possibly damaging 0.77
R6012:Mrps28 UTSW 3 8899984 critical splice donor site probably null
R6029:Mrps28 UTSW 3 8923745 missense possibly damaging 0.56
R6229:Mrps28 UTSW 3 8900037 missense probably damaging 1.00
R7845:Mrps28 UTSW 3 8923715 missense possibly damaging 0.48
Z1177:Mrps28 UTSW 3 8923746 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAACACTGAATGTCATTTCTTTCGG -3'
(R):5'- TCTCCAAAACCTGTGGAGTCC -3'

Sequencing Primer
(F):5'- TTATCAGGCTGGCCTCGAAATCAG -3'
(R):5'- AAAACCTGTGGAGTCCTTCGC -3'
Posted On2018-05-21