Mutagenetix > Incidental Mutation

Incidental Mutation 'R6415:Tanc1'

517844

Institutional Source

Beutler Lab

Gene Symbol

Tanc1

Ensembl Gene

ENSMUSG00000035168

Gene Name

tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1

Synonyms

1200003E16Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6415 (G1)

Quality Score

224.009

Status

Validated

Chromosome

Chromosomal Location

59612042-59846149 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 59837114 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1233 (V1233A)

Ref Sequence

ENSEMBL: ENSMUSP00000123345 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037526] [ENSMUST00000112568] [ENSMUST00000139863]

AlphaFold

Q0VGY8

Predicted Effect

probably benign
Transcript: ENSMUST00000037526
AA Change: V1233A

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000036003
Gene: ENSMUSG00000035168
AA Change: V1233A

Domain	Start	End	E-Value	Type
low complexity region	7	22	N/A	INTRINSIC
low complexity region	60	78	N/A	INTRINSIC
low complexity region	171	191	N/A	INTRINSIC
low complexity region	229	240	N/A	INTRINSIC
low complexity region	439	451	N/A	INTRINSIC
low complexity region	455	475	N/A	INTRINSIC
ANK	893	925	1.06e3	SMART
ANK	929	960	2.43e3	SMART
ANK	964	993	1.12e-3	SMART
Blast:ANK	997	1028	7e-12	BLAST
ANK	1037	1066	1.78e3	SMART
ANK	1075	1104	2.34e-1	SMART
ANK	1108	1137	3.71e-4	SMART
ANK	1141	1170	1.51e-4	SMART
ANK	1174	1203	4.89e-4	SMART
ANK	1207	1236	3.01e-4	SMART
ANK	1240	1269	1.99e2	SMART
TPR	1286	1319	7.49e1	SMART
TPR	1333	1366	2.35e-1	SMART
TPR	1367	1400	6.29e-2	SMART
low complexity region	1416	1432	N/A	INTRINSIC
low complexity region	1454	1483	N/A	INTRINSIC
low complexity region	1656	1686	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112568
AA Change: V1226A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000108187
Gene: ENSMUSG00000035168
AA Change: V1226A

Domain	Start	End	E-Value	Type
low complexity region	7	22	N/A	INTRINSIC
low complexity region	60	78	N/A	INTRINSIC
low complexity region	171	191	N/A	INTRINSIC
low complexity region	229	240	N/A	INTRINSIC
low complexity region	432	444	N/A	INTRINSIC
low complexity region	448	468	N/A	INTRINSIC
ANK	886	918	1.06e3	SMART
ANK	922	953	2.43e3	SMART
ANK	957	986	1.12e-3	SMART
Blast:ANK	990	1021	7e-12	BLAST
ANK	1030	1059	1.78e3	SMART
ANK	1068	1097	2.34e-1	SMART
ANK	1101	1130	3.71e-4	SMART
ANK	1134	1163	1.51e-4	SMART
ANK	1167	1196	4.89e-4	SMART
ANK	1200	1229	3.01e-4	SMART
ANK	1233	1262	1.99e2	SMART
TPR	1279	1312	7.49e1	SMART
TPR	1326	1359	2.35e-1	SMART
TPR	1360	1393	6.29e-2	SMART
low complexity region	1409	1425	N/A	INTRINSIC
low complexity region	1447	1476	N/A	INTRINSIC
low complexity region	1649	1679	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000139863
AA Change: V1233A

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000123345
Gene: ENSMUSG00000035168
AA Change: V1233A

Domain	Start	End	E-Value	Type
low complexity region	7	22	N/A	INTRINSIC
low complexity region	60	78	N/A	INTRINSIC
low complexity region	171	191	N/A	INTRINSIC
low complexity region	229	240	N/A	INTRINSIC
low complexity region	439	451	N/A	INTRINSIC
low complexity region	455	475	N/A	INTRINSIC
ANK	893	925	1.06e3	SMART
ANK	929	960	2.43e3	SMART
ANK	964	993	1.12e-3	SMART
Blast:ANK	997	1028	7e-12	BLAST
ANK	1037	1066	1.78e3	SMART
ANK	1075	1104	2.34e-1	SMART
ANK	1108	1137	3.71e-4	SMART
ANK	1141	1170	1.51e-4	SMART
ANK	1174	1203	4.89e-4	SMART
ANK	1207	1236	3.01e-4	SMART
ANK	1240	1269	1.99e2	SMART
TPR	1286	1319	7.49e1	SMART
TPR	1333	1366	2.35e-1	SMART
TPR	1367	1400	6.29e-2	SMART
low complexity region	1416	1432	N/A	INTRINSIC
low complexity region	1454	1483	N/A	INTRINSIC
low complexity region	1656	1686	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147650

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.8%
20x: 93.1%

Validation Efficiency

100% (65/65)

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene trap vector exhibit decreased spine density in the CA3 region and impaired spatial memory. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810403A07Rik	T	C	3: 88,699,972	F328L	probably benign	Het
4930563M21Rik	G	A	9: 55,974,012	T482M	probably benign	Het
9030624J02Rik	T	C	7: 118,792,646	W494R	probably damaging	Het
Adam9	A	G	8: 24,978,482	Y513H	probably damaging	Het
Adamts20	C	T	15: 94,324,659		probably null	Het
B3gnt5	A	G	16: 19,770,009	D326G	probably damaging	Het
Cacna1g	A	G	11: 94,463,417	I224T	probably damaging	Het
Ccdc18	A	G	5: 108,161,746	I402M	probably benign	Het
Cckar	A	T	5: 53,703,056	C73S	probably damaging	Het
Cdk13	C	T	13: 17,739,154	R880H	probably damaging	Het
Col1a1	A	G	11: 94,940,160	N218D	unknown	Het
Csnk1g2	T	C	10: 80,638,296	I145T	possibly damaging	Het
Cul5	T	C	9: 53,646,683	D207G	probably benign	Het
Cyp2c69	A	G	19: 39,842,921	F483L	probably benign	Het
Ddx60	A	G	8: 61,983,905	D963G	probably benign	Het
Dhx8	G	T	11: 101,737,687	A142S	unknown	Het
Dock7	C	T	4: 98,992,448	R926Q	probably damaging	Het
Dscaml1	C	T	9: 45,683,677	Q693*	probably null	Het
Dysf	G	A	6: 84,140,042	C1234Y	probably damaging	Het
Ercc1	G	A	7: 19,355,177		probably null	Het
Fam91a1	T	C	15: 58,442,917	L549P	probably damaging	Het
Fxyd2	T	A	9: 45,403,294	Y5N	possibly damaging	Het
Gab1	C	A	8: 80,788,597	R364L	possibly damaging	Het
Gpr182	T	A	10: 127,750,506	D192V	possibly damaging	Het
Gps1	T	C	11: 120,787,722	V286A	possibly damaging	Het
Grk1	A	G	8: 13,413,127	Y383C	probably damaging	Het
Hic1	G	A	11: 75,166,317	P582L	possibly damaging	Het
Hist1h2bn	T	C	13: 21,754,486	Y122H	probably benign	Het
Igkv4-61	C	A	6: 69,417,154	A31S	possibly damaging	Het
Lactb	T	C	9: 66,970,645	K301E	possibly damaging	Het
Lrp3	A	T	7: 35,204,168	V251E	probably benign	Het
Mapt	G	A	11: 104,298,998	G265S	probably benign	Het
Obscn	A	T	11: 59,035,130	D6245E	probably damaging	Het
Olfr118	G	T	17: 37,672,557	C178F	possibly damaging	Het
Olfr1257	T	C	2: 89,880,862	L12P	probably damaging	Het
Olfr1273-ps	T	A	2: 90,296,037	I275F	probably damaging	Het
Olfr340	A	G	2: 36,452,605	S7G	probably damaging	Het
Olfr58	T	A	9: 19,783,748	I205N	probably damaging	Het
Olfr777	T	C	10: 129,269,021	T101A	probably benign	Het
Olfr832	T	C	9: 18,945,119	L157P	probably damaging	Het
Oxsm	A	T	14: 16,241,904	H288Q	probably benign	Het
Pcdh9	C	T	14: 93,015,842	M1128I	possibly damaging	Het
Pcdha8	T	C	18: 36,994,561	Y699H	probably damaging	Het
Pgk2	A	T	17: 40,207,568	I323N	probably benign	Het
Plin4	A	G	17: 56,103,264	V1216A	probably damaging	Het
Ppargc1a	T	C	5: 51,462,834		probably benign	Het
Ppil2	A	G	16: 17,103,574		probably null	Het
Prelp	A	T	1: 133,912,778	I322N	probably benign	Het
Prelp	A	T	1: 133,914,657	I250N	probably damaging	Het
Prss27	T	A	17: 24,042,908	C63*	probably null	Het
Rab38	G	A	7: 88,430,540	A47T	possibly damaging	Het
Rprd2	G	A	3: 95,774,219	A436V	probably benign	Het
Sacs	A	T	14: 61,205,359	N1618I	probably damaging	Het
Scp2	T	G	4: 108,105,140	S63R	probably benign	Het
Sftpb	T	G	6: 72,304,649	W9G	probably damaging	Het
Slco1a4	A	T	6: 141,834,689	L125*	probably null	Het
Sptlc1	T	C	13: 53,351,692		probably null	Het
Sub1	T	A	15: 11,986,474	M96L	probably benign	Het
Tmem140	A	T	6: 34,872,723	D58V	probably damaging	Het
Tmem231	G	A	8: 111,926,892		probably benign	Het
Tpt1	T	C	14: 75,846,371	Y91H	probably benign	Het
Trap1	C	T	16: 4,043,992	R636H	possibly damaging	Het
Ttc14	A	G	3: 33,803,575	H275R	possibly damaging	Het
Zbtb44	T	A	9: 31,064,214	I380N	possibly damaging	Het
Zcchc6	T	A	13: 59,816,296		probably null	Het
Zswim5	T	C	4: 116,980,866	F798L	possibly damaging	Het

Other mutations in Tanc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Tanc1	APN	2	59790841	missense	possibly damaging	0.84
IGL00484:Tanc1	APN	2	59793176	missense	probably benign	0.00
IGL00688:Tanc1	APN	2	59815391	missense	probably damaging	1.00
IGL00765:Tanc1	APN	2	59806301	missense	probably benign	0.15
IGL01576:Tanc1	APN	2	59797735	missense	probably damaging	1.00
IGL01590:Tanc1	APN	2	59785473	missense	probably benign
IGL02016:Tanc1	APN	2	59843590	missense	probably benign	0.00
IGL02373:Tanc1	APN	2	59796028	critical splice donor site	probably null
IGL02539:Tanc1	APN	2	59833258	missense	probably damaging	1.00
IGL02540:Tanc1	APN	2	59833258	missense	probably damaging	1.00
IGL02541:Tanc1	APN	2	59833258	missense	probably damaging	1.00
IGL02543:Tanc1	APN	2	59833258	missense	probably damaging	1.00
IGL02559:Tanc1	APN	2	59724654	splice site	probably benign
IGL02626:Tanc1	APN	2	59799872	missense	probably damaging	1.00
IGL02669:Tanc1	APN	2	59799986	missense	probably damaging	1.00
IGL02902:Tanc1	APN	2	59793087	splice site	probably benign
Oreja	UTSW	2	59791804	synonymous	silent
R0178:Tanc1	UTSW	2	59835447	nonsense	probably null
R0347:Tanc1	UTSW	2	59842991	missense	probably benign
R0570:Tanc1	UTSW	2	59796038	splice site	probably benign
R0660:Tanc1	UTSW	2	59843884	nonsense	probably null
R0664:Tanc1	UTSW	2	59843884	nonsense	probably null
R0898:Tanc1	UTSW	2	59790788	missense	probably damaging	1.00
R1333:Tanc1	UTSW	2	59843491	missense	probably benign
R1575:Tanc1	UTSW	2	59791651	missense	probably damaging	1.00
R1608:Tanc1	UTSW	2	59797694	missense	possibly damaging	0.80
R1616:Tanc1	UTSW	2	59785387	missense	probably damaging	1.00
R1703:Tanc1	UTSW	2	59843021	missense	probably benign	0.02
R1727:Tanc1	UTSW	2	59790809	missense	probably damaging	1.00
R1809:Tanc1	UTSW	2	59800097	missense	probably damaging	1.00
R1812:Tanc1	UTSW	2	59791679	missense	probably damaging	1.00
R1925:Tanc1	UTSW	2	59724751	missense	possibly damaging	0.48
R1951:Tanc1	UTSW	2	59791812	missense	possibly damaging	0.92
R2174:Tanc1	UTSW	2	59843833	missense	possibly damaging	0.72
R2228:Tanc1	UTSW	2	59724724	missense	probably benign	0.04
R2267:Tanc1	UTSW	2	59837219	critical splice donor site	probably null
R4191:Tanc1	UTSW	2	59839013	missense	probably damaging	1.00
R4476:Tanc1	UTSW	2	59841996	splice site	probably null
R4632:Tanc1	UTSW	2	59795835	missense	probably damaging	1.00
R4825:Tanc1	UTSW	2	59699422	missense	probably damaging	1.00
R4982:Tanc1	UTSW	2	59799943	missense	probably damaging	1.00
R5338:Tanc1	UTSW	2	59795834	missense	probably damaging	1.00
R5657:Tanc1	UTSW	2	59834707	splice site	probably null
R5672:Tanc1	UTSW	2	59772353	missense	possibly damaging	0.81
R5703:Tanc1	UTSW	2	59795997	missense	probably damaging	0.98
R5707:Tanc1	UTSW	2	59758530	missense	probably benign
R5778:Tanc1	UTSW	2	59699347	critical splice acceptor site	probably null
R5795:Tanc1	UTSW	2	59807582	missense	possibly damaging	0.62
R5831:Tanc1	UTSW	2	59785341	missense	possibly damaging	0.89
R5849:Tanc1	UTSW	2	59799904	missense	probably benign	0.00
R5912:Tanc1	UTSW	2	59791686	missense	possibly damaging	0.92
R5944:Tanc1	UTSW	2	59837220	critical splice donor site	probably null
R6057:Tanc1	UTSW	2	59817493	missense	possibly damaging	0.46
R6142:Tanc1	UTSW	2	59833222	nonsense	probably null
R6179:Tanc1	UTSW	2	59842976	missense	probably benign	0.42
R6185:Tanc1	UTSW	2	59791585	splice site	probably null
R6192:Tanc1	UTSW	2	59838961	splice site	probably null
R6196:Tanc1	UTSW	2	59844022	missense	possibly damaging	0.94
R6197:Tanc1	UTSW	2	59844022	missense	possibly damaging	0.94
R6230:Tanc1	UTSW	2	59842031	missense	probably damaging	1.00
R6275:Tanc1	UTSW	2	59843510	missense	probably benign	0.22
R6480:Tanc1	UTSW	2	59807642	missense	probably damaging	1.00
R6578:Tanc1	UTSW	2	59795954	missense	probably damaging	1.00
R6786:Tanc1	UTSW	2	59791806	missense	probably benign	0.00
R7006:Tanc1	UTSW	2	59795844	missense	probably damaging	1.00
R7133:Tanc1	UTSW	2	59797609	missense	probably benign	0.16
R7381:Tanc1	UTSW	2	59785326	missense	probably damaging	1.00
R7422:Tanc1	UTSW	2	59806344	missense	probably benign	0.02
R8392:Tanc1	UTSW	2	59806307	missense	probably damaging	0.99
R8692:Tanc1	UTSW	2	59843645	missense	probably benign	0.01
R8730:Tanc1	UTSW	2	59771246	missense	probably benign	0.00
R8731:Tanc1	UTSW	2	59843252	missense	probably benign	0.01
R8813:Tanc1	UTSW	2	59799921	missense	probably damaging	1.00
R8815:Tanc1	UTSW	2	59790841	missense	possibly damaging	0.84
R8933:Tanc1	UTSW	2	59785456	missense	possibly damaging	0.92
R9015:Tanc1	UTSW	2	59791880	missense	probably benign
R9042:Tanc1	UTSW	2	59843422	missense	probably benign	0.00
R9154:Tanc1	UTSW	2	59799788	missense	probably damaging	1.00
R9269:Tanc1	UTSW	2	59800088	missense	probably damaging	1.00
R9283:Tanc1	UTSW	2	59799830	missense	probably damaging	0.99
R9380:Tanc1	UTSW	2	59835452	missense	probably damaging	1.00
R9422:Tanc1	UTSW	2	59807589	missense	probably benign	0.08
R9428:Tanc1	UTSW	2	59771204	missense	probably damaging	1.00
R9694:Tanc1	UTSW	2	59795852	missense	probably damaging	1.00
RF028:Tanc1	UTSW	2	59843269	small deletion	probably benign
RF049:Tanc1	UTSW	2	59843269	small deletion	probably benign
X0063:Tanc1	UTSW	2	59843980	nonsense	probably null
X0064:Tanc1	UTSW	2	59844112	missense	probably damaging	1.00
Z1176:Tanc1	UTSW	2	59772529	missense	possibly damaging	0.93
Z1177:Tanc1	UTSW	2	59790887	missense	probably benign
Z1177:Tanc1	UTSW	2	59791830	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGATGTTCGCCATTGTAGTGC -3'
(R):5'- GCAGGTACTCTTTAGGTCTTTCAGG -3'

Sequencing Primer
(F):5'- GGTGTCACATTGGTTTTATTTCCAC -3'
(R):5'- GTAAGATGTTAGAAGCCAACCCTCTG -3'

Posted On

2018-05-24