Incidental Mutation 'R6415:Lrp3'
ID517862
Institutional Source Beutler Lab
Gene Symbol Lrp3
Ensembl Gene ENSMUSG00000001802
Gene Namelow density lipoprotein receptor-related protein 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R6415 (G1)
Quality Score100.008
Status Validated
Chromosome7
Chromosomal Location35200027-35215498 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 35204168 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 251 (V251E)
Ref Sequence ENSEMBL: ENSMUSP00000114026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001854] [ENSMUST00000118444] [ENSMUST00000122409] [ENSMUST00000131048]
Predicted Effect probably benign
Transcript: ENSMUST00000001854
SMART Domains Protein: ENSMUSP00000001854
Gene: ENSMUSG00000030495

DomainStartEndE-ValueType
low complexity region 14 37 N/A INTRINSIC
Pfam:AA_permease_2 46 474 4.8e-65 PFAM
Pfam:AA_permease 51 467 9.3e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118444
AA Change: V230E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113406
Gene: ENSMUSG00000001802
AA Change: V230E

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
CUB 43 159 9.97e-20 SMART
LDLa 165 202 7.21e-11 SMART
LDLa 211 251 1.37e-11 SMART
CUB 254 365 1.98e-3 SMART
LDLa 367 414 1.85e-1 SMART
LDLa 415 453 4.44e-3 SMART
LDLa 454 490 8.74e-10 SMART
transmembrane domain 497 519 N/A INTRINSIC
low complexity region 584 606 N/A INTRINSIC
low complexity region 641 652 N/A INTRINSIC
low complexity region 674 684 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122409
AA Change: V251E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000114026
Gene: ENSMUSG00000001802
AA Change: V251E

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
CUB 64 180 9.97e-20 SMART
LDLa 186 223 7.21e-11 SMART
LDLa 232 272 1.37e-11 SMART
CUB 275 386 1.98e-3 SMART
LDLa 388 435 1.85e-1 SMART
LDLa 436 474 4.44e-3 SMART
LDLa 475 511 8.74e-10 SMART
transmembrane domain 518 540 N/A INTRINSIC
low complexity region 605 627 N/A INTRINSIC
low complexity region 662 673 N/A INTRINSIC
low complexity region 695 705 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131048
SMART Domains Protein: ENSMUSP00000118331
Gene: ENSMUSG00000030495

DomainStartEndE-ValueType
low complexity region 14 37 N/A INTRINSIC
Pfam:AA_permease_2 46 346 8.6e-48 PFAM
Pfam:AA_permease 51 346 1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146959
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153163
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155404
Meta Mutation Damage Score 0.0743 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T C 3: 88,699,972 F328L probably benign Het
4930563M21Rik G A 9: 55,974,012 T482M probably benign Het
9030624J02Rik T C 7: 118,792,646 W494R probably damaging Het
Adam9 A G 8: 24,978,482 Y513H probably damaging Het
Adamts20 C T 15: 94,324,659 probably null Het
B3gnt5 A G 16: 19,770,009 D326G probably damaging Het
Cacna1g A G 11: 94,463,417 I224T probably damaging Het
Ccdc18 A G 5: 108,161,746 I402M probably benign Het
Cckar A T 5: 53,703,056 C73S probably damaging Het
Cdk13 C T 13: 17,739,154 R880H probably damaging Het
Col1a1 A G 11: 94,940,160 N218D unknown Het
Csnk1g2 T C 10: 80,638,296 I145T possibly damaging Het
Cul5 T C 9: 53,646,683 D207G probably benign Het
Cyp2c69 A G 19: 39,842,921 F483L probably benign Het
Ddx60 A G 8: 61,983,905 D963G probably benign Het
Dhx8 G T 11: 101,737,687 A142S unknown Het
Dock7 C T 4: 98,992,448 R926Q probably damaging Het
Dscaml1 C T 9: 45,683,677 Q693* probably null Het
Dysf G A 6: 84,140,042 C1234Y probably damaging Het
Ercc1 G A 7: 19,355,177 probably null Het
Fam91a1 T C 15: 58,442,917 L549P probably damaging Het
Fxyd2 T A 9: 45,403,294 Y5N possibly damaging Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Gpr182 T A 10: 127,750,506 D192V possibly damaging Het
Gps1 T C 11: 120,787,722 V286A possibly damaging Het
Grk1 A G 8: 13,413,127 Y383C probably damaging Het
Hic1 G A 11: 75,166,317 P582L possibly damaging Het
Hist1h2bn T C 13: 21,754,486 Y122H probably benign Het
Igkv4-61 C A 6: 69,417,154 A31S possibly damaging Het
Lactb T C 9: 66,970,645 K301E possibly damaging Het
Mapt G A 11: 104,298,998 G265S probably benign Het
Obscn A T 11: 59,035,130 D6245E probably damaging Het
Olfr118 G T 17: 37,672,557 C178F possibly damaging Het
Olfr1257 T C 2: 89,880,862 L12P probably damaging Het
Olfr1273-ps T A 2: 90,296,037 I275F probably damaging Het
Olfr340 A G 2: 36,452,605 S7G probably damaging Het
Olfr58 T A 9: 19,783,748 I205N probably damaging Het
Olfr777 T C 10: 129,269,021 T101A probably benign Het
Olfr832 T C 9: 18,945,119 L157P probably damaging Het
Oxsm A T 14: 16,241,904 H288Q probably benign Het
Pcdh9 C T 14: 93,015,842 M1128I possibly damaging Het
Pcdha8 T C 18: 36,994,561 Y699H probably damaging Het
Pgk2 A T 17: 40,207,568 I323N probably benign Het
Plin4 A G 17: 56,103,264 V1216A probably damaging Het
Ppargc1a T C 5: 51,462,834 probably benign Het
Ppil2 A G 16: 17,103,574 probably null Het
Prelp A T 1: 133,912,778 I322N probably benign Het
Prelp A T 1: 133,914,657 I250N probably damaging Het
Prss27 T A 17: 24,042,908 C63* probably null Het
Rab38 G A 7: 88,430,540 A47T possibly damaging Het
Rprd2 G A 3: 95,774,219 A436V probably benign Het
Sacs A T 14: 61,205,359 N1618I probably damaging Het
Scp2 T G 4: 108,105,140 S63R probably benign Het
Sftpb T G 6: 72,304,649 W9G probably damaging Het
Slco1a4 A T 6: 141,834,689 L125* probably null Het
Sptlc1 T C 13: 53,351,692 probably null Het
Sub1 T A 15: 11,986,474 M96L probably benign Het
Tanc1 T C 2: 59,837,114 V1233A probably benign Het
Tmem140 A T 6: 34,872,723 D58V probably damaging Het
Tmem231 G A 8: 111,926,892 probably benign Het
Tpt1 T C 14: 75,846,371 Y91H probably benign Het
Trap1 C T 16: 4,043,992 R636H possibly damaging Het
Ttc14 A G 3: 33,803,575 H275R possibly damaging Het
Zbtb44 T A 9: 31,064,214 I380N possibly damaging Het
Zcchc6 T A 13: 59,816,296 probably null Het
Zswim5 T C 4: 116,980,866 F798L possibly damaging Het
Other mutations in Lrp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Lrp3 APN 7 35206028 splice site probably benign
IGL01714:Lrp3 APN 7 35206071 unclassified probably null
IGL03033:Lrp3 APN 7 35202627 missense possibly damaging 0.61
IGL03166:Lrp3 APN 7 35202480 missense probably benign 0.00
Blackball UTSW 7 35206052 missense probably damaging 1.00
lowball UTSW 7 35204168 missense probably benign 0.00
PIT4434001:Lrp3 UTSW 7 35203995 missense probably damaging 0.99
R0416:Lrp3 UTSW 7 35202353 missense probably benign
R0733:Lrp3 UTSW 7 35202120 missense possibly damaging 0.93
R0907:Lrp3 UTSW 7 35203293 missense probably damaging 0.99
R1437:Lrp3 UTSW 7 35213170 missense probably damaging 1.00
R1591:Lrp3 UTSW 7 35202365 missense probably benign 0.03
R1625:Lrp3 UTSW 7 35203925 missense probably damaging 1.00
R1703:Lrp3 UTSW 7 35213161 missense possibly damaging 0.95
R3976:Lrp3 UTSW 7 35204105 missense probably benign 0.06
R4196:Lrp3 UTSW 7 35203410 missense probably damaging 1.00
R4679:Lrp3 UTSW 7 35203940 missense probably damaging 1.00
R5686:Lrp3 UTSW 7 35203485 missense possibly damaging 0.84
R5836:Lrp3 UTSW 7 35203322 missense probably damaging 1.00
R6160:Lrp3 UTSW 7 35204123 missense possibly damaging 0.79
R6342:Lrp3 UTSW 7 35202306 missense probably benign 0.01
R6364:Lrp3 UTSW 7 35203709 missense probably benign 0.03
R6502:Lrp3 UTSW 7 35203988 missense possibly damaging 0.89
R6747:Lrp3 UTSW 7 35211437 missense probably benign
R7205:Lrp3 UTSW 7 35202626 missense probably damaging 0.99
R7232:Lrp3 UTSW 7 35206052 missense probably damaging 1.00
R7522:Lrp3 UTSW 7 35204330 missense probably damaging 0.99
R7870:Lrp3 UTSW 7 35211497 missense probably damaging 0.99
R7953:Lrp3 UTSW 7 35211497 missense probably damaging 0.99
Z1177:Lrp3 UTSW 7 35203012 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CATAACCCAGTCGTAGCTCC -3'
(R):5'- CGCTGTGACAACGGTAAATGC -3'

Sequencing Primer
(F):5'- GTCCTGCGTGTCCACCAG -3'
(R):5'- AACGGTAAATGCCTGCCTG -3'
Posted On2018-05-24