Incidental Mutation 'R6415:Zbtb44'
ID517871
Institutional Source Beutler Lab
Gene Symbol Zbtb44
Ensembl Gene ENSMUSG00000047412
Gene Namezinc finger and BTB domain containing 44
SynonymsBtbd15, 6030404E16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.457) question?
Stock #R6415 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location31030644-31075885 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31064214 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 380 (I380N)
Ref Sequence ENSEMBL: ENSMUSP00000110877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115222] [ENSMUST00000167346] [ENSMUST00000216649] [ENSMUST00000217092]
Predicted Effect possibly damaging
Transcript: ENSMUST00000115222
AA Change: I380N

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110877
Gene: ENSMUSG00000047412
AA Change: I380N

DomainStartEndE-ValueType
BTB 31 128 3.58e-26 SMART
low complexity region 304 318 N/A INTRINSIC
ZnF_C2H2 399 421 2.43e-4 SMART
ZnF_C2H2 427 449 3.11e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167346
SMART Domains Protein: ENSMUSP00000133109
Gene: ENSMUSG00000047412

DomainStartEndE-ValueType
BTB 31 128 3.58e-26 SMART
low complexity region 304 318 N/A INTRINSIC
ZnF_C2H2 381 403 2.43e-4 SMART
ZnF_C2H2 409 431 3.11e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000214585
Predicted Effect probably benign
Transcript: ENSMUST00000216649
Predicted Effect possibly damaging
Transcript: ENSMUST00000217092
AA Change: I380N

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T C 3: 88,699,972 F328L probably benign Het
4930563M21Rik G A 9: 55,974,012 T482M probably benign Het
9030624J02Rik T C 7: 118,792,646 W494R probably damaging Het
Adam9 A G 8: 24,978,482 Y513H probably damaging Het
Adamts20 C T 15: 94,324,659 probably null Het
B3gnt5 A G 16: 19,770,009 D326G probably damaging Het
Cacna1g A G 11: 94,463,417 I224T probably damaging Het
Ccdc18 A G 5: 108,161,746 I402M probably benign Het
Cckar A T 5: 53,703,056 C73S probably damaging Het
Cdk13 C T 13: 17,739,154 R880H probably damaging Het
Col1a1 A G 11: 94,940,160 N218D unknown Het
Csnk1g2 T C 10: 80,638,296 I145T possibly damaging Het
Cul5 T C 9: 53,646,683 D207G probably benign Het
Cyp2c69 A G 19: 39,842,921 F483L probably benign Het
Ddx60 A G 8: 61,983,905 D963G probably benign Het
Dhx8 G T 11: 101,737,687 A142S unknown Het
Dock7 C T 4: 98,992,448 R926Q probably damaging Het
Dscaml1 C T 9: 45,683,677 Q693* probably null Het
Dysf G A 6: 84,140,042 C1234Y probably damaging Het
Ercc1 G A 7: 19,355,177 probably null Het
Fam91a1 T C 15: 58,442,917 L549P probably damaging Het
Fxyd2 T A 9: 45,403,294 Y5N possibly damaging Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Gpr182 T A 10: 127,750,506 D192V possibly damaging Het
Gps1 T C 11: 120,787,722 V286A possibly damaging Het
Grk1 A G 8: 13,413,127 Y383C probably damaging Het
Hic1 G A 11: 75,166,317 P582L possibly damaging Het
Hist1h2bn T C 13: 21,754,486 Y122H probably benign Het
Igkv4-61 C A 6: 69,417,154 A31S possibly damaging Het
Lactb T C 9: 66,970,645 K301E possibly damaging Het
Lrp3 A T 7: 35,204,168 V251E probably benign Het
Mapt G A 11: 104,298,998 G265S probably benign Het
Obscn A T 11: 59,035,130 D6245E probably damaging Het
Olfr118 G T 17: 37,672,557 C178F possibly damaging Het
Olfr1257 T C 2: 89,880,862 L12P probably damaging Het
Olfr1273-ps T A 2: 90,296,037 I275F probably damaging Het
Olfr340 A G 2: 36,452,605 S7G probably damaging Het
Olfr58 T A 9: 19,783,748 I205N probably damaging Het
Olfr777 T C 10: 129,269,021 T101A probably benign Het
Olfr832 T C 9: 18,945,119 L157P probably damaging Het
Oxsm A T 14: 16,241,904 H288Q probably benign Het
Pcdh9 C T 14: 93,015,842 M1128I possibly damaging Het
Pcdha8 T C 18: 36,994,561 Y699H probably damaging Het
Pgk2 A T 17: 40,207,568 I323N probably benign Het
Plin4 A G 17: 56,103,264 V1216A probably damaging Het
Ppargc1a T C 5: 51,462,834 probably benign Het
Ppil2 A G 16: 17,103,574 probably null Het
Prelp A T 1: 133,912,778 I322N probably benign Het
Prelp A T 1: 133,914,657 I250N probably damaging Het
Prss27 T A 17: 24,042,908 C63* probably null Het
Rab38 G A 7: 88,430,540 A47T possibly damaging Het
Rprd2 G A 3: 95,774,219 A436V probably benign Het
Sacs A T 14: 61,205,359 N1618I probably damaging Het
Scp2 T G 4: 108,105,140 S63R probably benign Het
Sftpb T G 6: 72,304,649 W9G probably damaging Het
Slco1a4 A T 6: 141,834,689 L125* probably null Het
Sptlc1 T C 13: 53,351,692 probably null Het
Sub1 T A 15: 11,986,474 M96L probably benign Het
Tanc1 T C 2: 59,837,114 V1233A probably benign Het
Tmem140 A T 6: 34,872,723 D58V probably damaging Het
Tmem231 G A 8: 111,926,892 probably benign Het
Tpt1 T C 14: 75,846,371 Y91H probably benign Het
Trap1 C T 16: 4,043,992 R636H possibly damaging Het
Ttc14 A G 3: 33,803,575 H275R possibly damaging Het
Zcchc6 T A 13: 59,816,296 probably null Het
Zswim5 T C 4: 116,980,866 F798L possibly damaging Het
Other mutations in Zbtb44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Zbtb44 APN 9 31054310 missense possibly damaging 0.78
IGL01464:Zbtb44 APN 9 31054284 missense probably damaging 1.00
IGL02162:Zbtb44 APN 9 31053392 missense probably benign 0.00
IGL03295:Zbtb44 APN 9 31053457 missense probably benign 0.00
IGL03412:Zbtb44 APN 9 31053467 missense probably benign 0.08
R0137:Zbtb44 UTSW 9 31066710 missense probably damaging 1.00
R2182:Zbtb44 UTSW 9 31066676 missense possibly damaging 0.94
R2511:Zbtb44 UTSW 9 31054243 missense probably damaging 0.99
R4501:Zbtb44 UTSW 9 31054166 missense probably damaging 1.00
R4557:Zbtb44 UTSW 9 31064248 missense probably damaging 1.00
R4841:Zbtb44 UTSW 9 31053405 missense probably damaging 1.00
R5391:Zbtb44 UTSW 9 31053305 unclassified probably null
R5639:Zbtb44 UTSW 9 31054052 missense probably damaging 0.98
R6001:Zbtb44 UTSW 9 31053794 missense probably damaging 1.00
R6170:Zbtb44 UTSW 9 31053382 missense probably damaging 1.00
R7658:Zbtb44 UTSW 9 31054079 missense probably benign 0.00
R7913:Zbtb44 UTSW 9 31054208 nonsense probably null
R7994:Zbtb44 UTSW 9 31054208 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTCCACACTAAAGATGCTGG -3'
(R):5'- CAGGATTGCAAAGCACAACG -3'

Sequencing Primer
(F):5'- CCACACTAAAGATGCTGGACATTTAG -3'
(R):5'- ACACTGAAACGGTCTGTC -3'
Posted On2018-05-24