Incidental Mutation 'R6415:Col1a1'
ID517883
Institutional Source Beutler Lab
Gene Symbol Col1a1
Ensembl Gene ENSMUSG00000001506
Gene Namecollagen, type I, alpha 1
SynonymsCola1, Mov-13, Col1a-1, Cola-1
MMRRC Submission
Accession Numbers

MGI: 88467

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6415 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location94936224-94953042 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94940160 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 218 (N218D)
Ref Sequence ENSEMBL: ENSMUSP00000001547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001547]
Predicted Effect unknown
Transcript: ENSMUST00000001547
AA Change: N218D
SMART Domains Protein: ENSMUSP00000001547
Gene: ENSMUSG00000001506
AA Change: N218D

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWC 31 86 1.04e-16 SMART
Pfam:Collagen 97 154 1.1e-9 PFAM
Pfam:Collagen 166 227 7e-10 PFAM
Pfam:Collagen 225 284 2.4e-13 PFAM
Pfam:Collagen 285 344 5.9e-12 PFAM
low complexity region 354 426 N/A INTRINSIC
internal_repeat_4 427 444 4.93e-7 PROSPERO
low complexity region 447 486 N/A INTRINSIC
low complexity region 495 516 N/A INTRINSIC
low complexity region 527 567 N/A INTRINSIC
internal_repeat_3 570 588 1.25e-9 PROSPERO
low complexity region 590 600 N/A INTRINSIC
low complexity region 603 627 N/A INTRINSIC
low complexity region 629 651 N/A INTRINSIC
internal_repeat_1 652 675 6.29e-11 PROSPERO
internal_repeat_4 658 675 4.93e-7 PROSPERO
low complexity region 678 699 N/A INTRINSIC
low complexity region 702 717 N/A INTRINSIC
internal_repeat_2 718 738 2.08e-10 PROSPERO
internal_repeat_1 718 741 6.29e-11 PROSPERO
internal_repeat_3 726 744 1.25e-9 PROSPERO
internal_repeat_5 737 752 9.8e-6 PROSPERO
Pfam:Collagen 768 827 2.8e-12 PFAM
Pfam:Collagen 828 887 6.8e-11 PFAM
internal_repeat_5 944 959 9.8e-6 PROSPERO
internal_repeat_2 952 972 2.08e-10 PROSPERO
Pfam:Collagen 1008 1077 4.8e-8 PFAM
Pfam:Collagen 1068 1127 1.2e-12 PFAM
Pfam:Collagen 1122 1184 2.8e-9 PFAM
PDB:3HR2|C 1185 1205 6e-6 PDB
COLFI 1217 1453 2.04e-162 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148593
Meta Mutation Damage Score 0.0852 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of the fibril-forming type I collagen, the most abundant protein of bone, skin and tendon extracellular matrices. The encoded protein, in association with alpha-2 subunit, forms heterotrimeric type I procollagen that undergoes proteolytic processing during fibril formation. Mice lacking the encoded protein die in utero caused by the rupture of a major blood vessel. Transgenic mice expressing significantly lower levels of this gene exhibit morphological and functional defects in mineralized and non-mineralized connective tissue and, progressive loss of hearing. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutations in this locus cause variable phenotype, from embryonic lethal to viable/fertile with altered fibrillogenesis. Homozygotes can show impaired bone formation and fragility, osteoporosis, dermal fibrosis, impaired uterine postpartum involution, andaortic dissection. [provided by MGI curators]
Allele List at MGI

All alleles(46) : Targeted(40) Gene trapped(3) Transgenic(1) Chemically induced(2)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T C 3: 88,699,972 F328L probably benign Het
4930563M21Rik G A 9: 55,974,012 T482M probably benign Het
9030624J02Rik T C 7: 118,792,646 W494R probably damaging Het
Adam9 A G 8: 24,978,482 Y513H probably damaging Het
Adamts20 C T 15: 94,324,659 probably null Het
B3gnt5 A G 16: 19,770,009 D326G probably damaging Het
Cacna1g A G 11: 94,463,417 I224T probably damaging Het
Ccdc18 A G 5: 108,161,746 I402M probably benign Het
Cckar A T 5: 53,703,056 C73S probably damaging Het
Cdk13 C T 13: 17,739,154 R880H probably damaging Het
Csnk1g2 T C 10: 80,638,296 I145T possibly damaging Het
Cul5 T C 9: 53,646,683 D207G probably benign Het
Cyp2c69 A G 19: 39,842,921 F483L probably benign Het
Ddx60 A G 8: 61,983,905 D963G probably benign Het
Dhx8 G T 11: 101,737,687 A142S unknown Het
Dock7 C T 4: 98,992,448 R926Q probably damaging Het
Dscaml1 C T 9: 45,683,677 Q693* probably null Het
Dysf G A 6: 84,140,042 C1234Y probably damaging Het
Ercc1 G A 7: 19,355,177 probably null Het
Fam91a1 T C 15: 58,442,917 L549P probably damaging Het
Fxyd2 T A 9: 45,403,294 Y5N possibly damaging Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Gpr182 T A 10: 127,750,506 D192V possibly damaging Het
Gps1 T C 11: 120,787,722 V286A possibly damaging Het
Grk1 A G 8: 13,413,127 Y383C probably damaging Het
Hic1 G A 11: 75,166,317 P582L possibly damaging Het
Hist1h2bn T C 13: 21,754,486 Y122H probably benign Het
Igkv4-61 C A 6: 69,417,154 A31S possibly damaging Het
Lactb T C 9: 66,970,645 K301E possibly damaging Het
Lrp3 A T 7: 35,204,168 V251E probably benign Het
Mapt G A 11: 104,298,998 G265S probably benign Het
Obscn A T 11: 59,035,130 D6245E probably damaging Het
Olfr118 G T 17: 37,672,557 C178F possibly damaging Het
Olfr1257 T C 2: 89,880,862 L12P probably damaging Het
Olfr1273-ps T A 2: 90,296,037 I275F probably damaging Het
Olfr340 A G 2: 36,452,605 S7G probably damaging Het
Olfr58 T A 9: 19,783,748 I205N probably damaging Het
Olfr777 T C 10: 129,269,021 T101A probably benign Het
Olfr832 T C 9: 18,945,119 L157P probably damaging Het
Oxsm A T 14: 16,241,904 H288Q probably benign Het
Pcdh9 C T 14: 93,015,842 M1128I possibly damaging Het
Pcdha8 T C 18: 36,994,561 Y699H probably damaging Het
Pgk2 A T 17: 40,207,568 I323N probably benign Het
Plin4 A G 17: 56,103,264 V1216A probably damaging Het
Ppargc1a T C 5: 51,462,834 probably benign Het
Ppil2 A G 16: 17,103,574 probably null Het
Prelp A T 1: 133,912,778 I322N probably benign Het
Prelp A T 1: 133,914,657 I250N probably damaging Het
Prss27 T A 17: 24,042,908 C63* probably null Het
Rab38 G A 7: 88,430,540 A47T possibly damaging Het
Rprd2 G A 3: 95,774,219 A436V probably benign Het
Sacs A T 14: 61,205,359 N1618I probably damaging Het
Scp2 T G 4: 108,105,140 S63R probably benign Het
Sftpb T G 6: 72,304,649 W9G probably damaging Het
Slco1a4 A T 6: 141,834,689 L125* probably null Het
Sptlc1 T C 13: 53,351,692 probably null Het
Sub1 T A 15: 11,986,474 M96L probably benign Het
Tanc1 T C 2: 59,837,114 V1233A probably benign Het
Tmem140 A T 6: 34,872,723 D58V probably damaging Het
Tmem231 G A 8: 111,926,892 probably benign Het
Tpt1 T C 14: 75,846,371 Y91H probably benign Het
Trap1 C T 16: 4,043,992 R636H possibly damaging Het
Ttc14 A G 3: 33,803,575 H275R possibly damaging Het
Zbtb44 T A 9: 31,064,214 I380N possibly damaging Het
Zcchc6 T A 13: 59,816,296 probably null Het
Zswim5 T C 4: 116,980,866 F798L possibly damaging Het
Other mutations in Col1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Col1a1 APN 11 94949378 missense unknown
IGL01383:Col1a1 APN 11 94945525 missense probably damaging 1.00
IGL01717:Col1a1 APN 11 94950777 missense unknown
IGL02889:Col1a1 APN 11 94951509 missense unknown
seal UTSW 11 94947184 splice site probably benign
walrus UTSW 11 94942385 missense unknown
R0121:Col1a1 UTSW 11 94938069 missense unknown
R0400:Col1a1 UTSW 11 94941369 splice site probably benign
R0545:Col1a1 UTSW 11 94951594 missense unknown
R0661:Col1a1 UTSW 11 94949389 missense unknown
R1220:Col1a1 UTSW 11 94951131 missense unknown
R1717:Col1a1 UTSW 11 94948392 missense unknown
R1732:Col1a1 UTSW 11 94944415 splice site probably benign
R1879:Col1a1 UTSW 11 94951225 missense unknown
R1880:Col1a1 UTSW 11 94950568 missense unknown
R1901:Col1a1 UTSW 11 94946632 splice site probably null
R2113:Col1a1 UTSW 11 94948362 missense unknown
R2386:Col1a1 UTSW 11 94950391 missense unknown
R3803:Col1a1 UTSW 11 94938069 missense unknown
R4839:Col1a1 UTSW 11 94950095 critical splice acceptor site probably null
R4936:Col1a1 UTSW 11 94947132 missense unknown
R5081:Col1a1 UTSW 11 94951576 missense unknown
R5105:Col1a1 UTSW 11 94942385 missense unknown
R5110:Col1a1 UTSW 11 94941593 critical splice donor site probably null
R5247:Col1a1 UTSW 11 94947187 splice site probably null
R5773:Col1a1 UTSW 11 94939429 missense probably benign 0.10
R5776:Col1a1 UTSW 11 94949724 missense unknown
R5991:Col1a1 UTSW 11 94937919 missense unknown
R6483:Col1a1 UTSW 11 94942618 splice site probably null
R7207:Col1a1 UTSW 11 94938526 missense unknown
R7853:Col1a1 UTSW 11 94947679 missense unknown
R7936:Col1a1 UTSW 11 94947679 missense unknown
RF007:Col1a1 UTSW 11 94943040 missense probably damaging 1.00
Z1177:Col1a1 UTSW 11 94943804 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- GTCCACAAGGTTTCCAAGGC -3'
(R):5'- GGCTGCCTCACTAAAACATTC -3'

Sequencing Primer
(F):5'- AGTAAGTTAGTCCTCCATGCCGAC -3'
(R):5'- CTATTCAGTGGAAAGATGACTGCC -3'
Posted On2018-05-24