Incidental Mutation 'R6415:Dhx8'
ID517884
Institutional Source Beutler Lab
Gene Symbol Dhx8
Ensembl Gene ENSMUSG00000034931
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 8
SynonymsRNA helicase, Ddx8, mDEAH6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R6415 (G1)
Quality Score196.009
Status Validated
Chromosome11
Chromosomal Location101732919-101767358 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 101737687 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 142 (A142S)
Ref Sequence ENSEMBL: ENSMUSP00000037251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039152] [ENSMUST00000129741]
Predicted Effect unknown
Transcript: ENSMUST00000039152
AA Change: A142S
SMART Domains Protein: ENSMUSP00000037251
Gene: ENSMUSG00000034931
AA Change: A142S

DomainStartEndE-ValueType
low complexity region 2 8 N/A INTRINSIC
low complexity region 168 240 N/A INTRINSIC
low complexity region 244 254 N/A INTRINSIC
S1 287 360 3.52e-18 SMART
low complexity region 453 469 N/A INTRINSIC
coiled coil region 496 525 N/A INTRINSIC
DEXDc 587 771 7.26e-33 SMART
HELICc 815 919 7.45e-21 SMART
HA2 980 1070 1.34e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125409
Predicted Effect unknown
Transcript: ENSMUST00000129741
AA Change: A89S
SMART Domains Protein: ENSMUSP00000119430
Gene: ENSMUSG00000034931
AA Change: A89S

DomainStartEndE-ValueType
low complexity region 2 8 N/A INTRINSIC
low complexity region 115 187 N/A INTRINSIC
low complexity region 191 201 N/A INTRINSIC
S1 234 307 3.52e-18 SMART
low complexity region 400 416 N/A INTRINSIC
coiled coil region 443 472 N/A INTRINSIC
DEXDc 534 718 7.26e-33 SMART
HELICc 762 866 7.45e-21 SMART
HA2 927 1017 1.34e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156842
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the DEAH box polypeptide family. The encoded protein contains the DEAH (Asp-Glu-Ala-His) motif which is characteristic of all DEAH box proteins, and is thought to function as an ATP-dependent RNA helicase that regulates the release of spliced mRNAs from spliceosomes prior to their export from the nucleus. This protein may be required for the replication of human immunodeficiency virus type 1 (HIV-1). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T C 3: 88,699,972 F328L probably benign Het
4930563M21Rik G A 9: 55,974,012 T482M probably benign Het
9030624J02Rik T C 7: 118,792,646 W494R probably damaging Het
Adam9 A G 8: 24,978,482 Y513H probably damaging Het
Adamts20 C T 15: 94,324,659 probably null Het
B3gnt5 A G 16: 19,770,009 D326G probably damaging Het
Cacna1g A G 11: 94,463,417 I224T probably damaging Het
Ccdc18 A G 5: 108,161,746 I402M probably benign Het
Cckar A T 5: 53,703,056 C73S probably damaging Het
Cdk13 C T 13: 17,739,154 R880H probably damaging Het
Col1a1 A G 11: 94,940,160 N218D unknown Het
Csnk1g2 T C 10: 80,638,296 I145T possibly damaging Het
Cul5 T C 9: 53,646,683 D207G probably benign Het
Cyp2c69 A G 19: 39,842,921 F483L probably benign Het
Ddx60 A G 8: 61,983,905 D963G probably benign Het
Dock7 C T 4: 98,992,448 R926Q probably damaging Het
Dscaml1 C T 9: 45,683,677 Q693* probably null Het
Dysf G A 6: 84,140,042 C1234Y probably damaging Het
Ercc1 G A 7: 19,355,177 probably null Het
Fam91a1 T C 15: 58,442,917 L549P probably damaging Het
Fxyd2 T A 9: 45,403,294 Y5N possibly damaging Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Gpr182 T A 10: 127,750,506 D192V possibly damaging Het
Gps1 T C 11: 120,787,722 V286A possibly damaging Het
Grk1 A G 8: 13,413,127 Y383C probably damaging Het
Hic1 G A 11: 75,166,317 P582L possibly damaging Het
Hist1h2bn T C 13: 21,754,486 Y122H probably benign Het
Igkv4-61 C A 6: 69,417,154 A31S possibly damaging Het
Lactb T C 9: 66,970,645 K301E possibly damaging Het
Lrp3 A T 7: 35,204,168 V251E probably benign Het
Mapt G A 11: 104,298,998 G265S probably benign Het
Obscn A T 11: 59,035,130 D6245E probably damaging Het
Olfr118 G T 17: 37,672,557 C178F possibly damaging Het
Olfr1257 T C 2: 89,880,862 L12P probably damaging Het
Olfr1273-ps T A 2: 90,296,037 I275F probably damaging Het
Olfr340 A G 2: 36,452,605 S7G probably damaging Het
Olfr58 T A 9: 19,783,748 I205N probably damaging Het
Olfr777 T C 10: 129,269,021 T101A probably benign Het
Olfr832 T C 9: 18,945,119 L157P probably damaging Het
Oxsm A T 14: 16,241,904 H288Q probably benign Het
Pcdh9 C T 14: 93,015,842 M1128I possibly damaging Het
Pcdha8 T C 18: 36,994,561 Y699H probably damaging Het
Pgk2 A T 17: 40,207,568 I323N probably benign Het
Plin4 A G 17: 56,103,264 V1216A probably damaging Het
Ppargc1a T C 5: 51,462,834 probably benign Het
Ppil2 A G 16: 17,103,574 probably null Het
Prelp A T 1: 133,912,778 I322N probably benign Het
Prelp A T 1: 133,914,657 I250N probably damaging Het
Prss27 T A 17: 24,042,908 C63* probably null Het
Rab38 G A 7: 88,430,540 A47T possibly damaging Het
Rprd2 G A 3: 95,774,219 A436V probably benign Het
Sacs A T 14: 61,205,359 N1618I probably damaging Het
Scp2 T G 4: 108,105,140 S63R probably benign Het
Sftpb T G 6: 72,304,649 W9G probably damaging Het
Slco1a4 A T 6: 141,834,689 L125* probably null Het
Sptlc1 T C 13: 53,351,692 probably null Het
Sub1 T A 15: 11,986,474 M96L probably benign Het
Tanc1 T C 2: 59,837,114 V1233A probably benign Het
Tmem140 A T 6: 34,872,723 D58V probably damaging Het
Tmem231 G A 8: 111,926,892 probably benign Het
Tpt1 T C 14: 75,846,371 Y91H probably benign Het
Trap1 C T 16: 4,043,992 R636H possibly damaging Het
Ttc14 A G 3: 33,803,575 H275R possibly damaging Het
Zbtb44 T A 9: 31,064,214 I380N possibly damaging Het
Zcchc6 T A 13: 59,816,296 probably null Het
Zswim5 T C 4: 116,980,866 F798L possibly damaging Het
Other mutations in Dhx8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01922:Dhx8 APN 11 101739807 missense probably damaging 0.99
IGL01957:Dhx8 APN 11 101754826 missense possibly damaging 0.48
IGL02039:Dhx8 APN 11 101764027 critical splice donor site probably null
IGL02115:Dhx8 APN 11 101752388 missense probably damaging 1.00
IGL02161:Dhx8 APN 11 101757606 missense probably damaging 1.00
IGL02691:Dhx8 APN 11 101752004 splice site probably benign
IGL02697:Dhx8 APN 11 101754781 missense probably damaging 1.00
FR4304:Dhx8 UTSW 11 101738188 small insertion probably benign
FR4342:Dhx8 UTSW 11 101738206 frame shift probably null
FR4449:Dhx8 UTSW 11 101738184 small insertion probably benign
FR4449:Dhx8 UTSW 11 101738190 small deletion probably benign
FR4449:Dhx8 UTSW 11 101738194 small insertion probably benign
FR4449:Dhx8 UTSW 11 101738206 small insertion probably benign
FR4449:Dhx8 UTSW 11 101738207 small insertion probably benign
FR4589:Dhx8 UTSW 11 101738188 small insertion probably benign
FR4737:Dhx8 UTSW 11 101738179 small insertion probably benign
FR4737:Dhx8 UTSW 11 101738182 small insertion probably benign
FR4737:Dhx8 UTSW 11 101738189 small insertion probably benign
R0402:Dhx8 UTSW 11 101752397 missense probably damaging 1.00
R0525:Dhx8 UTSW 11 101763928 missense probably damaging 1.00
R0969:Dhx8 UTSW 11 101739700 splice site probably benign
R1497:Dhx8 UTSW 11 101735387 intron probably benign
R1576:Dhx8 UTSW 11 101752319 missense probably damaging 1.00
R1758:Dhx8 UTSW 11 101766738 missense probably damaging 1.00
R1773:Dhx8 UTSW 11 101752363 missense possibly damaging 0.87
R1941:Dhx8 UTSW 11 101752198 critical splice donor site probably null
R1954:Dhx8 UTSW 11 101753279 missense probably damaging 0.98
R2124:Dhx8 UTSW 11 101762245 missense probably damaging 0.99
R2128:Dhx8 UTSW 11 101738409 missense probably benign 0.06
R2148:Dhx8 UTSW 11 101738377 nonsense probably null
R2206:Dhx8 UTSW 11 101750971 missense probably benign 0.03
R2207:Dhx8 UTSW 11 101750971 missense probably benign 0.03
R4667:Dhx8 UTSW 11 101738161 missense unknown
R4678:Dhx8 UTSW 11 101739808 missense probably damaging 1.00
R4825:Dhx8 UTSW 11 101738170 nonsense probably null
R4943:Dhx8 UTSW 11 101737700 nonsense probably null
R5341:Dhx8 UTSW 11 101738190 small deletion probably benign
R5586:Dhx8 UTSW 11 101733036 unclassified probably benign
R5662:Dhx8 UTSW 11 101766758 missense possibly damaging 0.89
R5664:Dhx8 UTSW 11 101740751 missense probably damaging 1.00
R6082:Dhx8 UTSW 11 101764313 missense probably damaging 1.00
R6085:Dhx8 UTSW 11 101764313 missense probably damaging 1.00
R6658:Dhx8 UTSW 11 101764922 missense probably damaging 1.00
R6841:Dhx8 UTSW 11 101764792 missense probably damaging 0.98
R6918:Dhx8 UTSW 11 101738421 nonsense probably null
R7011:Dhx8 UTSW 11 101741520 missense probably damaging 1.00
R7098:Dhx8 UTSW 11 101737768 critical splice donor site probably null
R7153:Dhx8 UTSW 11 101740175 intron probably null
R7284:Dhx8 UTSW 11 101754822 missense probably damaging 1.00
R7604:Dhx8 UTSW 11 101764797 missense probably damaging 1.00
Z1177:Dhx8 UTSW 11 101757660 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGTCGCAGTGGATAGCAG -3'
(R):5'- AGACACAGCCTGTTAAGAGTC -3'

Sequencing Primer
(F):5'- AAAGTTTTCACATCTGGAGCCGG -3'
(R):5'- AGCCTGTTAAGAGTCTACACACTTTC -3'
Posted On2018-05-24