Incidental Mutation 'R6415:Zcchc6'
ID517890
Institutional Source Beutler Lab
Gene Symbol Zcchc6
Ensembl Gene ENSMUSG00000035248
Gene Namezinc finger, CCHC domain containing 6
Synonyms6030448M23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.612) question?
Stock #R6415 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location59771561-59823147 bp(-) (GRCm38)
Type of Mutationunclassified (3817 bp from exon)
DNA Base Change (assembly) T to A at 59816296 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071703] [ENSMUST00000225576]
Predicted Effect probably damaging
Transcript: ENSMUST00000071703
AA Change: E265V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000071623
Gene: ENSMUSG00000035248
AA Change: E265V

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
low complexity region 176 190 N/A INTRINSIC
ZnF_C2H2 244 268 2.61e1 SMART
SCOP:d1f5aa2 284 497 4e-25 SMART
low complexity region 522 534 N/A INTRINSIC
Pfam:PAP_assoc 550 603 6.7e-14 PFAM
low complexity region 811 825 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
low complexity region 882 898 N/A INTRINSIC
ZnF_C2HC 960 976 3.3e-3 SMART
Pfam:NTP_transf_2 1022 1134 4e-8 PFAM
Pfam:PAP_assoc 1229 1282 1.7e-17 PFAM
ZnF_C2HC 1342 1358 2.09e-3 SMART
Pfam:TUTF7_u4 1359 1446 1.6e-42 PFAM
ZnF_C2HC 1448 1464 1.06e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000225576
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T C 3: 88,699,972 F328L probably benign Het
4930563M21Rik G A 9: 55,974,012 T482M probably benign Het
9030624J02Rik T C 7: 118,792,646 W494R probably damaging Het
Adam9 A G 8: 24,978,482 Y513H probably damaging Het
Adamts20 C T 15: 94,324,659 probably null Het
B3gnt5 A G 16: 19,770,009 D326G probably damaging Het
Cacna1g A G 11: 94,463,417 I224T probably damaging Het
Ccdc18 A G 5: 108,161,746 I402M probably benign Het
Cckar A T 5: 53,703,056 C73S probably damaging Het
Cdk13 C T 13: 17,739,154 R880H probably damaging Het
Col1a1 A G 11: 94,940,160 N218D unknown Het
Csnk1g2 T C 10: 80,638,296 I145T possibly damaging Het
Cul5 T C 9: 53,646,683 D207G probably benign Het
Cyp2c69 A G 19: 39,842,921 F483L probably benign Het
Ddx60 A G 8: 61,983,905 D963G probably benign Het
Dhx8 G T 11: 101,737,687 A142S unknown Het
Dock7 C T 4: 98,992,448 R926Q probably damaging Het
Dscaml1 C T 9: 45,683,677 Q693* probably null Het
Dysf G A 6: 84,140,042 C1234Y probably damaging Het
Ercc1 G A 7: 19,355,177 probably null Het
Fam91a1 T C 15: 58,442,917 L549P probably damaging Het
Fxyd2 T A 9: 45,403,294 Y5N possibly damaging Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Gpr182 T A 10: 127,750,506 D192V possibly damaging Het
Gps1 T C 11: 120,787,722 V286A possibly damaging Het
Grk1 A G 8: 13,413,127 Y383C probably damaging Het
Hic1 G A 11: 75,166,317 P582L possibly damaging Het
Hist1h2bn T C 13: 21,754,486 Y122H probably benign Het
Igkv4-61 C A 6: 69,417,154 A31S possibly damaging Het
Lactb T C 9: 66,970,645 K301E possibly damaging Het
Lrp3 A T 7: 35,204,168 V251E probably benign Het
Mapt G A 11: 104,298,998 G265S probably benign Het
Obscn A T 11: 59,035,130 D6245E probably damaging Het
Olfr118 G T 17: 37,672,557 C178F possibly damaging Het
Olfr1257 T C 2: 89,880,862 L12P probably damaging Het
Olfr1273-ps T A 2: 90,296,037 I275F probably damaging Het
Olfr340 A G 2: 36,452,605 S7G probably damaging Het
Olfr58 T A 9: 19,783,748 I205N probably damaging Het
Olfr777 T C 10: 129,269,021 T101A probably benign Het
Olfr832 T C 9: 18,945,119 L157P probably damaging Het
Oxsm A T 14: 16,241,904 H288Q probably benign Het
Pcdh9 C T 14: 93,015,842 M1128I possibly damaging Het
Pcdha8 T C 18: 36,994,561 Y699H probably damaging Het
Pgk2 A T 17: 40,207,568 I323N probably benign Het
Plin4 A G 17: 56,103,264 V1216A probably damaging Het
Ppargc1a T C 5: 51,462,834 probably benign Het
Ppil2 A G 16: 17,103,574 probably null Het
Prelp A T 1: 133,912,778 I322N probably benign Het
Prelp A T 1: 133,914,657 I250N probably damaging Het
Prss27 T A 17: 24,042,908 C63* probably null Het
Rab38 G A 7: 88,430,540 A47T possibly damaging Het
Rprd2 G A 3: 95,774,219 A436V probably benign Het
Sacs A T 14: 61,205,359 N1618I probably damaging Het
Scp2 T G 4: 108,105,140 S63R probably benign Het
Sftpb T G 6: 72,304,649 W9G probably damaging Het
Slco1a4 A T 6: 141,834,689 L125* probably null Het
Sptlc1 T C 13: 53,351,692 probably null Het
Sub1 T A 15: 11,986,474 M96L probably benign Het
Tanc1 T C 2: 59,837,114 V1233A probably benign Het
Tmem140 A T 6: 34,872,723 D58V probably damaging Het
Tmem231 G A 8: 111,926,892 probably benign Het
Tpt1 T C 14: 75,846,371 Y91H probably benign Het
Trap1 C T 16: 4,043,992 R636H possibly damaging Het
Ttc14 A G 3: 33,803,575 H275R possibly damaging Het
Zbtb44 T A 9: 31,064,214 I380N possibly damaging Het
Zswim5 T C 4: 116,980,866 F798L possibly damaging Het
Other mutations in Zcchc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Zcchc6 APN 13 59816698 missense probably damaging 1.00
IGL01361:Zcchc6 APN 13 59785800 missense probably damaging 1.00
IGL02002:Zcchc6 APN 13 59782096 missense possibly damaging 0.76
IGL02015:Zcchc6 APN 13 59789258 missense probably damaging 1.00
IGL02029:Zcchc6 APN 13 59784888 unclassified probably benign
IGL02216:Zcchc6 APN 13 59800423 missense probably benign 0.01
IGL02705:Zcchc6 APN 13 59789203 missense probably damaging 1.00
IGL02742:Zcchc6 APN 13 59816342 missense probably damaging 0.99
IGL02810:Zcchc6 APN 13 59782016 critical splice donor site probably null
IGL02942:Zcchc6 APN 13 59811521 missense probably damaging 0.98
IGL03104:Zcchc6 APN 13 59814903 missense probably benign 0.04
R0025:Zcchc6 UTSW 13 59805328 missense probably benign 0.08
R0025:Zcchc6 UTSW 13 59805328 missense probably benign 0.08
R0153:Zcchc6 UTSW 13 59782336 nonsense probably null
R0269:Zcchc6 UTSW 13 59816855 intron probably null
R0358:Zcchc6 UTSW 13 59782104 missense probably damaging 0.99
R0555:Zcchc6 UTSW 13 59800317 missense probably benign 0.00
R0599:Zcchc6 UTSW 13 59809487 missense probably damaging 1.00
R0609:Zcchc6 UTSW 13 59799782 nonsense probably null
R0617:Zcchc6 UTSW 13 59816855 intron probably null
R0680:Zcchc6 UTSW 13 59800599 missense possibly damaging 0.79
R0699:Zcchc6 UTSW 13 59782014 splice site probably benign
R1214:Zcchc6 UTSW 13 59805326 missense possibly damaging 0.76
R1271:Zcchc6 UTSW 13 59821855 missense probably damaging 0.99
R1556:Zcchc6 UTSW 13 59800240 missense probably benign 0.02
R1662:Zcchc6 UTSW 13 59799903 missense possibly damaging 0.93
R1777:Zcchc6 UTSW 13 59791821 missense probably damaging 1.00
R1834:Zcchc6 UTSW 13 59814935 nonsense probably null
R1928:Zcchc6 UTSW 13 59816734 missense probably damaging 1.00
R2012:Zcchc6 UTSW 13 59811538 missense probably damaging 0.99
R2045:Zcchc6 UTSW 13 59800656 missense probably damaging 1.00
R2336:Zcchc6 UTSW 13 59799054 missense probably damaging 1.00
R3764:Zcchc6 UTSW 13 59800380 missense probably damaging 0.98
R3899:Zcchc6 UTSW 13 59789255 nonsense probably null
R3918:Zcchc6 UTSW 13 59782024 missense probably damaging 1.00
R4423:Zcchc6 UTSW 13 59822049 missense probably damaging 0.96
R4664:Zcchc6 UTSW 13 59800599 missense possibly damaging 0.79
R4673:Zcchc6 UTSW 13 59796845 missense probably damaging 1.00
R4770:Zcchc6 UTSW 13 59772884 unclassified probably benign
R4884:Zcchc6 UTSW 13 59789452 missense probably damaging 1.00
R5186:Zcchc6 UTSW 13 59816656 critical splice donor site probably null
R5337:Zcchc6 UTSW 13 59791852 missense probably damaging 1.00
R5385:Zcchc6 UTSW 13 59789846 critical splice donor site probably null
R5452:Zcchc6 UTSW 13 59800657 missense probably damaging 1.00
R5534:Zcchc6 UTSW 13 59788553 missense probably damaging 1.00
R5566:Zcchc6 UTSW 13 59788629 nonsense probably null
R5928:Zcchc6 UTSW 13 59822066 missense probably benign 0.16
R5994:Zcchc6 UTSW 13 59789209 missense probably damaging 1.00
R6495:Zcchc6 UTSW 13 59799939 missense possibly damaging 0.95
R6577:Zcchc6 UTSW 13 59808161 missense probably damaging 1.00
R7205:Zcchc6 UTSW 13 59788550 missense probably damaging 1.00
R7286:Zcchc6 UTSW 13 59821649 missense probably benign 0.18
R7355:Zcchc6 UTSW 13 59821802 missense probably benign 0.00
R7369:Zcchc6 UTSW 13 59782053 missense possibly damaging 0.71
R7455:Zcchc6 UTSW 13 59822057 missense probably benign 0.03
R7557:Zcchc6 UTSW 13 59788466 missense possibly damaging 0.89
R7635:Zcchc6 UTSW 13 59800090 missense probably benign 0.03
R7727:Zcchc6 UTSW 13 59799682 missense probably benign 0.00
R7798:Zcchc6 UTSW 13 59815575 missense possibly damaging 0.81
R7912:Zcchc6 UTSW 13 59799005 missense probably damaging 1.00
R7993:Zcchc6 UTSW 13 59799005 missense probably damaging 1.00
R8035:Zcchc6 UTSW 13 59789190 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAATCTCCCAGTGAAGGCAGAC -3'
(R):5'- GCCAAGGGATAATTAGCATGAC -3'

Sequencing Primer
(F):5'- CCAGTGAAGGCAGACACAACTG -3'
(R):5'- TGACTGTCAAGCTTGGAAGTAAC -3'
Posted On2018-05-24