Incidental Mutation 'R6415:Fam91a1'
ID517896
Institutional Source Beutler Lab
Gene Symbol Fam91a1
Ensembl Gene ENSMUSG00000037119
Gene Namefamily with sequence similarity 91, member A1
SynonymsD15Ertd621e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6415 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location58415468-58457740 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58442917 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 549 (L549P)
Ref Sequence ENSEMBL: ENSMUSP00000036524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037270]
Predicted Effect probably damaging
Transcript: ENSMUST00000037270
AA Change: L549P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036524
Gene: ENSMUSG00000037119
AA Change: L549P

DomainStartEndE-ValueType
Pfam:FAM91_N 8 312 2.8e-149 PFAM
Pfam:FAM91_C 374 821 3.8e-182 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228576
Meta Mutation Damage Score 0.6686 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 100% (65/65)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T C 3: 88,699,972 F328L probably benign Het
4930563M21Rik G A 9: 55,974,012 T482M probably benign Het
9030624J02Rik T C 7: 118,792,646 W494R probably damaging Het
Adam9 A G 8: 24,978,482 Y513H probably damaging Het
Adamts20 C T 15: 94,324,659 probably null Het
B3gnt5 A G 16: 19,770,009 D326G probably damaging Het
Cacna1g A G 11: 94,463,417 I224T probably damaging Het
Ccdc18 A G 5: 108,161,746 I402M probably benign Het
Cckar A T 5: 53,703,056 C73S probably damaging Het
Cdk13 C T 13: 17,739,154 R880H probably damaging Het
Col1a1 A G 11: 94,940,160 N218D unknown Het
Csnk1g2 T C 10: 80,638,296 I145T possibly damaging Het
Cul5 T C 9: 53,646,683 D207G probably benign Het
Cyp2c69 A G 19: 39,842,921 F483L probably benign Het
Ddx60 A G 8: 61,983,905 D963G probably benign Het
Dhx8 G T 11: 101,737,687 A142S unknown Het
Dock7 C T 4: 98,992,448 R926Q probably damaging Het
Dscaml1 C T 9: 45,683,677 Q693* probably null Het
Dysf G A 6: 84,140,042 C1234Y probably damaging Het
Ercc1 G A 7: 19,355,177 probably null Het
Fxyd2 T A 9: 45,403,294 Y5N possibly damaging Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Gpr182 T A 10: 127,750,506 D192V possibly damaging Het
Gps1 T C 11: 120,787,722 V286A possibly damaging Het
Grk1 A G 8: 13,413,127 Y383C probably damaging Het
Hic1 G A 11: 75,166,317 P582L possibly damaging Het
Hist1h2bn T C 13: 21,754,486 Y122H probably benign Het
Igkv4-61 C A 6: 69,417,154 A31S possibly damaging Het
Lactb T C 9: 66,970,645 K301E possibly damaging Het
Lrp3 A T 7: 35,204,168 V251E probably benign Het
Mapt G A 11: 104,298,998 G265S probably benign Het
Obscn A T 11: 59,035,130 D6245E probably damaging Het
Olfr118 G T 17: 37,672,557 C178F possibly damaging Het
Olfr1257 T C 2: 89,880,862 L12P probably damaging Het
Olfr1273-ps T A 2: 90,296,037 I275F probably damaging Het
Olfr340 A G 2: 36,452,605 S7G probably damaging Het
Olfr58 T A 9: 19,783,748 I205N probably damaging Het
Olfr777 T C 10: 129,269,021 T101A probably benign Het
Olfr832 T C 9: 18,945,119 L157P probably damaging Het
Oxsm A T 14: 16,241,904 H288Q probably benign Het
Pcdh9 C T 14: 93,015,842 M1128I possibly damaging Het
Pcdha8 T C 18: 36,994,561 Y699H probably damaging Het
Pgk2 A T 17: 40,207,568 I323N probably benign Het
Plin4 A G 17: 56,103,264 V1216A probably damaging Het
Ppargc1a T C 5: 51,462,834 probably benign Het
Ppil2 A G 16: 17,103,574 probably null Het
Prelp A T 1: 133,912,778 I322N probably benign Het
Prelp A T 1: 133,914,657 I250N probably damaging Het
Prss27 T A 17: 24,042,908 C63* probably null Het
Rab38 G A 7: 88,430,540 A47T possibly damaging Het
Rprd2 G A 3: 95,774,219 A436V probably benign Het
Sacs A T 14: 61,205,359 N1618I probably damaging Het
Scp2 T G 4: 108,105,140 S63R probably benign Het
Sftpb T G 6: 72,304,649 W9G probably damaging Het
Slco1a4 A T 6: 141,834,689 L125* probably null Het
Sptlc1 T C 13: 53,351,692 probably null Het
Sub1 T A 15: 11,986,474 M96L probably benign Het
Tanc1 T C 2: 59,837,114 V1233A probably benign Het
Tmem140 A T 6: 34,872,723 D58V probably damaging Het
Tmem231 G A 8: 111,926,892 probably benign Het
Tpt1 T C 14: 75,846,371 Y91H probably benign Het
Trap1 C T 16: 4,043,992 R636H possibly damaging Het
Ttc14 A G 3: 33,803,575 H275R possibly damaging Het
Zbtb44 T A 9: 31,064,214 I380N possibly damaging Het
Zcchc6 T A 13: 59,816,296 probably null Het
Zswim5 T C 4: 116,980,866 F798L possibly damaging Het
Other mutations in Fam91a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Fam91a1 APN 15 58430735 missense probably damaging 0.99
IGL00590:Fam91a1 APN 15 58415716 missense possibly damaging 0.66
IGL01301:Fam91a1 APN 15 58442871 missense probably damaging 0.99
IGL01372:Fam91a1 APN 15 58430062 missense probably damaging 1.00
IGL01979:Fam91a1 APN 15 58432584 missense probably damaging 1.00
IGL02085:Fam91a1 APN 15 58441656 missense possibly damaging 0.95
IGL02553:Fam91a1 APN 15 58432982 critical splice donor site probably null
IGL02605:Fam91a1 APN 15 58431196 splice site probably benign
IGL02882:Fam91a1 APN 15 58453061 splice site probably benign
IGL02894:Fam91a1 APN 15 58443231 missense probably benign 0.09
ANU18:Fam91a1 UTSW 15 58442871 missense probably damaging 0.99
H8562:Fam91a1 UTSW 15 58427121 splice site probably null
R0395:Fam91a1 UTSW 15 58454792 missense probably benign
R1165:Fam91a1 UTSW 15 58430669 missense possibly damaging 0.90
R1699:Fam91a1 UTSW 15 58432948 missense probably benign 0.04
R1749:Fam91a1 UTSW 15 58426594 missense probably benign 0.02
R1997:Fam91a1 UTSW 15 58424195 critical splice acceptor site probably null
R2042:Fam91a1 UTSW 15 58426594 missense probably benign 0.02
R2188:Fam91a1 UTSW 15 58430663 missense probably damaging 0.98
R2518:Fam91a1 UTSW 15 58450600 missense possibly damaging 0.92
R3124:Fam91a1 UTSW 15 58421889 missense probably benign 0.34
R3916:Fam91a1 UTSW 15 58430734 missense probably damaging 1.00
R4810:Fam91a1 UTSW 15 58434740 missense probably damaging 1.00
R4959:Fam91a1 UTSW 15 58431210 missense probably benign 0.16
R4973:Fam91a1 UTSW 15 58431210 missense probably benign 0.16
R5288:Fam91a1 UTSW 15 58448394 missense probably benign
R5385:Fam91a1 UTSW 15 58448394 missense probably benign
R5386:Fam91a1 UTSW 15 58448394 missense probably benign
R5941:Fam91a1 UTSW 15 58431317 missense probably benign 0.01
R6869:Fam91a1 UTSW 15 58431268 missense probably benign 0.00
R7175:Fam91a1 UTSW 15 58430678 missense probably benign 0.06
R7872:Fam91a1 UTSW 15 58448360 missense probably benign 0.01
R7955:Fam91a1 UTSW 15 58448360 missense probably benign 0.01
X0024:Fam91a1 UTSW 15 58430189 missense probably damaging 0.98
Z1177:Fam91a1 UTSW 15 58432548 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TGGGCATATATCTTCATCCCAGTG -3'
(R):5'- CACATGAAACGGCACTTTGAGAG -3'

Sequencing Primer
(F):5'- TCTTCATCCCAGTGTGAAAACAAAAC -3'
(R):5'- CGAAACTGACCTAATTCTGCATAG -3'
Posted On2018-05-24