Incidental Mutation 'R6415:Trap1'
ID517898
Institutional Source Beutler Lab
Gene Symbol Trap1
Ensembl Gene ENSMUSG00000005981
Gene NameTNF receptor-associated protein 1
SynonymsHSP75, 2410002K23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6415 (G1)
Quality Score189.009
Status Validated
Chromosome16
Chromosomal Location4039971-4077827 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 4043992 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 636 (R636H)
Ref Sequence ENSEMBL: ENSMUSP00000006137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006136] [ENSMUST00000006137] [ENSMUST00000120009] [ENSMUST00000137748] [ENSMUST00000175755] [ENSMUST00000177337]
Predicted Effect probably benign
Transcript: ENSMUST00000006136
SMART Domains Protein: ENSMUSP00000006136
Gene: ENSMUSG00000005980

DomainStartEndE-ValueType
DNaseIc 6 282 5.04e-220 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000006137
AA Change: R636H

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000006137
Gene: ENSMUSG00000005981
AA Change: R636H

DomainStartEndE-ValueType
HATPase_c 110 263 3.68e-3 SMART
Pfam:HSP90 290 706 2.6e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120009
SMART Domains Protein: ENSMUSP00000113119
Gene: ENSMUSG00000005980

DomainStartEndE-ValueType
DNaseIc 6 282 5.04e-220 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125961
Predicted Effect probably benign
Transcript: ENSMUST00000137748
SMART Domains Protein: ENSMUSP00000119934
Gene: ENSMUSG00000005980

DomainStartEndE-ValueType
DNaseIc 6 225 7.51e-146 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137945
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144792
Predicted Effect probably benign
Transcript: ENSMUST00000175755
SMART Domains Protein: ENSMUSP00000135060
Gene: ENSMUSG00000005980

DomainStartEndE-ValueType
SCOP:d2dnja_ 1 52 3e-9 SMART
Blast:DNaseIc 1 61 2e-31 BLAST
PDB:3W3D|B 1 61 5e-27 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176642
Predicted Effect probably benign
Transcript: ENSMUST00000177337
SMART Domains Protein: ENSMUSP00000135442
Gene: ENSMUSG00000005980

DomainStartEndE-ValueType
DNaseIc 6 200 6.86e-67 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial chaperone protein that is member of the heat shock protein 90 (HSP90) family. The encoded protein has ATPase activity and interacts with tumor necrosis factor type I. This protein may function in regulating cellular stress responses. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit reduced body weight; liver and spleen hyperplasia; decreased chronic inflammation and tumor incidents; deregulated mitochondrial respiration; and increased oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T C 3: 88,699,972 F328L probably benign Het
4930563M21Rik G A 9: 55,974,012 T482M probably benign Het
9030624J02Rik T C 7: 118,792,646 W494R probably damaging Het
Adam9 A G 8: 24,978,482 Y513H probably damaging Het
Adamts20 C T 15: 94,324,659 probably null Het
B3gnt5 A G 16: 19,770,009 D326G probably damaging Het
Cacna1g A G 11: 94,463,417 I224T probably damaging Het
Ccdc18 A G 5: 108,161,746 I402M probably benign Het
Cckar A T 5: 53,703,056 C73S probably damaging Het
Cdk13 C T 13: 17,739,154 R880H probably damaging Het
Col1a1 A G 11: 94,940,160 N218D unknown Het
Csnk1g2 T C 10: 80,638,296 I145T possibly damaging Het
Cul5 T C 9: 53,646,683 D207G probably benign Het
Cyp2c69 A G 19: 39,842,921 F483L probably benign Het
Ddx60 A G 8: 61,983,905 D963G probably benign Het
Dhx8 G T 11: 101,737,687 A142S unknown Het
Dock7 C T 4: 98,992,448 R926Q probably damaging Het
Dscaml1 C T 9: 45,683,677 Q693* probably null Het
Dysf G A 6: 84,140,042 C1234Y probably damaging Het
Ercc1 G A 7: 19,355,177 probably null Het
Fam91a1 T C 15: 58,442,917 L549P probably damaging Het
Fxyd2 T A 9: 45,403,294 Y5N possibly damaging Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Gpr182 T A 10: 127,750,506 D192V possibly damaging Het
Gps1 T C 11: 120,787,722 V286A possibly damaging Het
Grk1 A G 8: 13,413,127 Y383C probably damaging Het
Hic1 G A 11: 75,166,317 P582L possibly damaging Het
Hist1h2bn T C 13: 21,754,486 Y122H probably benign Het
Igkv4-61 C A 6: 69,417,154 A31S possibly damaging Het
Lactb T C 9: 66,970,645 K301E possibly damaging Het
Lrp3 A T 7: 35,204,168 V251E probably benign Het
Mapt G A 11: 104,298,998 G265S probably benign Het
Obscn A T 11: 59,035,130 D6245E probably damaging Het
Olfr118 G T 17: 37,672,557 C178F possibly damaging Het
Olfr1257 T C 2: 89,880,862 L12P probably damaging Het
Olfr1273-ps T A 2: 90,296,037 I275F probably damaging Het
Olfr340 A G 2: 36,452,605 S7G probably damaging Het
Olfr58 T A 9: 19,783,748 I205N probably damaging Het
Olfr777 T C 10: 129,269,021 T101A probably benign Het
Olfr832 T C 9: 18,945,119 L157P probably damaging Het
Oxsm A T 14: 16,241,904 H288Q probably benign Het
Pcdh9 C T 14: 93,015,842 M1128I possibly damaging Het
Pcdha8 T C 18: 36,994,561 Y699H probably damaging Het
Pgk2 A T 17: 40,207,568 I323N probably benign Het
Plin4 A G 17: 56,103,264 V1216A probably damaging Het
Ppargc1a T C 5: 51,462,834 probably benign Het
Ppil2 A G 16: 17,103,574 probably null Het
Prelp A T 1: 133,912,778 I322N probably benign Het
Prelp A T 1: 133,914,657 I250N probably damaging Het
Prss27 T A 17: 24,042,908 C63* probably null Het
Rab38 G A 7: 88,430,540 A47T possibly damaging Het
Rprd2 G A 3: 95,774,219 A436V probably benign Het
Sacs A T 14: 61,205,359 N1618I probably damaging Het
Scp2 T G 4: 108,105,140 S63R probably benign Het
Sftpb T G 6: 72,304,649 W9G probably damaging Het
Slco1a4 A T 6: 141,834,689 L125* probably null Het
Sptlc1 T C 13: 53,351,692 probably null Het
Sub1 T A 15: 11,986,474 M96L probably benign Het
Tanc1 T C 2: 59,837,114 V1233A probably benign Het
Tmem140 A T 6: 34,872,723 D58V probably damaging Het
Tmem231 G A 8: 111,926,892 probably benign Het
Tpt1 T C 14: 75,846,371 Y91H probably benign Het
Ttc14 A G 3: 33,803,575 H275R possibly damaging Het
Zbtb44 T A 9: 31,064,214 I380N possibly damaging Het
Zcchc6 T A 13: 59,816,296 probably null Het
Zswim5 T C 4: 116,980,866 F798L possibly damaging Het
Other mutations in Trap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01155:Trap1 APN 16 4043978 nonsense probably null
IGL03087:Trap1 APN 16 4044701 splice site probably null
E0354:Trap1 UTSW 16 4065288 missense probably benign 0.01
R0034:Trap1 UTSW 16 4069030 splice site probably benign
R0034:Trap1 UTSW 16 4069030 splice site probably benign
R0316:Trap1 UTSW 16 4045560 missense probably benign
R0336:Trap1 UTSW 16 4044626 missense probably damaging 0.99
R0614:Trap1 UTSW 16 4060751 splice site probably benign
R2069:Trap1 UTSW 16 4068336 missense probably benign
R2089:Trap1 UTSW 16 4046039 nonsense probably null
R2091:Trap1 UTSW 16 4046039 nonsense probably null
R2091:Trap1 UTSW 16 4046039 nonsense probably null
R2148:Trap1 UTSW 16 4060760 missense probably damaging 0.97
R2419:Trap1 UTSW 16 4068330 missense probably benign 0.23
R3853:Trap1 UTSW 16 4054822 missense possibly damaging 0.69
R4926:Trap1 UTSW 16 4045488 missense probably benign 0.27
R5120:Trap1 UTSW 16 4044088 missense probably damaging 1.00
R5261:Trap1 UTSW 16 4056422 missense probably damaging 1.00
R5434:Trap1 UTSW 16 4044665 missense probably benign 0.00
R6194:Trap1 UTSW 16 4054800 missense possibly damaging 0.94
R6284:Trap1 UTSW 16 4060809 missense probably benign 0.07
R7132:Trap1 UTSW 16 4055829 missense probably benign 0.17
R7167:Trap1 UTSW 16 4052928 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAAGGGCCTTGTAGAACG -3'
(R):5'- TATAGAGCCAATCTGCCTTCTACC -3'

Sequencing Primer
(F):5'- TTGTAGAACGTCCTGACACG -3'
(R):5'- GGTGGCCTAGTTAACTTCACAATGC -3'
Posted On2018-05-24