Mutagenetix > Incidental Mutation

Incidental Mutation 'R6415:B3gnt5'

517900

Institutional Source

Beutler Lab

Gene Symbol

B3gnt5

Ensembl Gene

ENSMUSG00000022686

Gene Name

UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.413) question?

Stock #

R6415 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

19760208-19772753 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 19770009 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 326 (D326G)

Ref Sequence

ENSEMBL: ENSMUSP00000126157 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079780] [ENSMUST00000119468] [ENSMUST00000121344] [ENSMUST00000164397]

AlphaFold

Q8BGY6

Predicted Effect

probably damaging
Transcript: ENSMUST00000079780
AA Change: D326G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000078712
Gene: ENSMUSG00000022686
AA Change: D326G

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
Pfam:Galactosyl_T	100	299	2e-49	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000119468
AA Change: D326G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113145
Gene: ENSMUSG00000022686
AA Change: D326G

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
Pfam:Galactosyl_T	100	299	2e-49	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000121344
AA Change: D326G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112624
Gene: ENSMUSG00000022686
AA Change: D326G

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
Pfam:Galactosyl_T	100	299	2e-49	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131557

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152845

Predicted Effect

probably damaging
Transcript: ENSMUST00000164397
AA Change: D326G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126157
Gene: ENSMUSG00000022686
AA Change: D326G

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
Pfam:Galactosyl_T	100	299	2e-49	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.8%
20x: 93.1%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta-1,3-N-acetylglucosaminyltransferase family. This enzyme is a type II membrane protein. It exhibits strong activity to transfer GlcNAc to glycolipid substrates and is identified as the most likely candidate for lactotriaosylceramide synthase. This enzyme is essential for the expression of Lewis X epitopes on glycolipids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice may show variable types of lethality or no lethality depending on the allele. Mice homozygous for 3 alleles show B cell abnormalities. Mice homozygous or heterozygous for 2 allele show reduced fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810403A07Rik	T	C	3: 88,699,972	F328L	probably benign	Het
4930563M21Rik	G	A	9: 55,974,012	T482M	probably benign	Het
9030624J02Rik	T	C	7: 118,792,646	W494R	probably damaging	Het
Adam9	A	G	8: 24,978,482	Y513H	probably damaging	Het
Adamts20	C	T	15: 94,324,659		probably null	Het
Cacna1g	A	G	11: 94,463,417	I224T	probably damaging	Het
Ccdc18	A	G	5: 108,161,746	I402M	probably benign	Het
Cckar	A	T	5: 53,703,056	C73S	probably damaging	Het
Cdk13	C	T	13: 17,739,154	R880H	probably damaging	Het
Col1a1	A	G	11: 94,940,160	N218D	unknown	Het
Csnk1g2	T	C	10: 80,638,296	I145T	possibly damaging	Het
Cul5	T	C	9: 53,646,683	D207G	probably benign	Het
Cyp2c69	A	G	19: 39,842,921	F483L	probably benign	Het
Ddx60	A	G	8: 61,983,905	D963G	probably benign	Het
Dhx8	G	T	11: 101,737,687	A142S	unknown	Het
Dock7	C	T	4: 98,992,448	R926Q	probably damaging	Het
Dscaml1	C	T	9: 45,683,677	Q693*	probably null	Het
Dysf	G	A	6: 84,140,042	C1234Y	probably damaging	Het
Ercc1	G	A	7: 19,355,177		probably null	Het
Fam91a1	T	C	15: 58,442,917	L549P	probably damaging	Het
Fxyd2	T	A	9: 45,403,294	Y5N	possibly damaging	Het
Gab1	C	A	8: 80,788,597	R364L	possibly damaging	Het
Gpr182	T	A	10: 127,750,506	D192V	possibly damaging	Het
Gps1	T	C	11: 120,787,722	V286A	possibly damaging	Het
Grk1	A	G	8: 13,413,127	Y383C	probably damaging	Het
Hic1	G	A	11: 75,166,317	P582L	possibly damaging	Het
Hist1h2bn	T	C	13: 21,754,486	Y122H	probably benign	Het
Igkv4-61	C	A	6: 69,417,154	A31S	possibly damaging	Het
Lactb	T	C	9: 66,970,645	K301E	possibly damaging	Het
Lrp3	A	T	7: 35,204,168	V251E	probably benign	Het
Mapt	G	A	11: 104,298,998	G265S	probably benign	Het
Obscn	A	T	11: 59,035,130	D6245E	probably damaging	Het
Olfr118	G	T	17: 37,672,557	C178F	possibly damaging	Het
Olfr1257	T	C	2: 89,880,862	L12P	probably damaging	Het
Olfr1273-ps	T	A	2: 90,296,037	I275F	probably damaging	Het
Olfr340	A	G	2: 36,452,605	S7G	probably damaging	Het
Olfr58	T	A	9: 19,783,748	I205N	probably damaging	Het
Olfr777	T	C	10: 129,269,021	T101A	probably benign	Het
Olfr832	T	C	9: 18,945,119	L157P	probably damaging	Het
Oxsm	A	T	14: 16,241,904	H288Q	probably benign	Het
Pcdh9	C	T	14: 93,015,842	M1128I	possibly damaging	Het
Pcdha8	T	C	18: 36,994,561	Y699H	probably damaging	Het
Pgk2	A	T	17: 40,207,568	I323N	probably benign	Het
Plin4	A	G	17: 56,103,264	V1216A	probably damaging	Het
Ppargc1a	T	C	5: 51,462,834		probably benign	Het
Ppil2	A	G	16: 17,103,574		probably null	Het
Prelp	A	T	1: 133,912,778	I322N	probably benign	Het
Prelp	A	T	1: 133,914,657	I250N	probably damaging	Het
Prss27	T	A	17: 24,042,908	C63*	probably null	Het
Rab38	G	A	7: 88,430,540	A47T	possibly damaging	Het
Rprd2	G	A	3: 95,774,219	A436V	probably benign	Het
Sacs	A	T	14: 61,205,359	N1618I	probably damaging	Het
Scp2	T	G	4: 108,105,140	S63R	probably benign	Het
Sftpb	T	G	6: 72,304,649	W9G	probably damaging	Het
Slco1a4	A	T	6: 141,834,689	L125*	probably null	Het
Sptlc1	T	C	13: 53,351,692		probably null	Het
Sub1	T	A	15: 11,986,474	M96L	probably benign	Het
Tanc1	T	C	2: 59,837,114	V1233A	probably benign	Het
Tmem140	A	T	6: 34,872,723	D58V	probably damaging	Het
Tmem231	G	A	8: 111,926,892		probably benign	Het
Tpt1	T	C	14: 75,846,371	Y91H	probably benign	Het
Trap1	C	T	16: 4,043,992	R636H	possibly damaging	Het
Ttc14	A	G	3: 33,803,575	H275R	possibly damaging	Het
Zbtb44	T	A	9: 31,064,214	I380N	possibly damaging	Het
Zcchc6	T	A	13: 59,816,296		probably null	Het
Zswim5	T	C	4: 116,980,866	F798L	possibly damaging	Het

Other mutations in B3gnt5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01352:B3gnt5	APN	16	19769213	missense	probably damaging	1.00
IGL01503:B3gnt5	APN	16	19769781	missense	probably damaging	1.00
IGL02623:B3gnt5	APN	16	19769610	missense	probably damaging	1.00
IGL02978:B3gnt5	APN	16	19769994	missense	probably damaging	1.00
IGL03355:B3gnt5	APN	16	19769153	missense	probably benign	0.01
IGL03388:B3gnt5	APN	16	19770051	missense	possibly damaging	0.83
R0180:B3gnt5	UTSW	16	19769100	missense	possibly damaging	0.48
R0973:B3gnt5	UTSW	16	19770010	missense	probably damaging	1.00
R0973:B3gnt5	UTSW	16	19770010	missense	probably damaging	1.00
R0974:B3gnt5	UTSW	16	19770010	missense	probably damaging	1.00
R1034:B3gnt5	UTSW	16	19769484	missense	probably damaging	1.00
R1435:B3gnt5	UTSW	16	19769174	missense	probably damaging	0.99
R1480:B3gnt5	UTSW	16	19769867	missense	probably damaging	1.00
R1533:B3gnt5	UTSW	16	19769614	missense	probably damaging	1.00
R1920:B3gnt5	UTSW	16	19769544	missense	probably benign	0.34
R3962:B3gnt5	UTSW	16	19769048	missense	probably benign	0.37
R3963:B3gnt5	UTSW	16	19769048	missense	probably benign	0.37
R4620:B3gnt5	UTSW	16	19769882	missense	probably benign	0.37
R4948:B3gnt5	UTSW	16	19769144	missense	probably benign
R4987:B3gnt5	UTSW	16	19769202	missense	probably damaging	1.00
R5027:B3gnt5	UTSW	16	19769694	missense	probably damaging	1.00
R7027:B3gnt5	UTSW	16	19769990	missense	probably damaging	1.00
R7224:B3gnt5	UTSW	16	19769753	missense	probably benign	0.06
R7261:B3gnt5	UTSW	16	19769373	missense	probably damaging	1.00
R7369:B3gnt5	UTSW	16	19769660	missense	probably benign	0.00
R8818:B3gnt5	UTSW	16	19769597	missense	possibly damaging	0.53
Z1176:B3gnt5	UTSW	16	19769810	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CCAGAGATGTAGCTGCCAAAATC -3'
(R):5'- AGTTTGGCTCAGTGACACTTAAC -3'

Sequencing Primer
(F):5'- TCTATGAGGCATCGCAGACACTG -3'
(R):5'- TGGCTCAGTGACACTTAACACAGTAC -3'

Posted On

2018-05-24