Incidental Mutation 'R6416:Chac1'
ID517911
Institutional Source Beutler Lab
Gene Symbol Chac1
Ensembl Gene ENSMUSG00000027313
Gene NameChaC, cation transport regulator 1
SynonymsBotch, 1810008K03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6416 (G1)
Quality Score217.009
Status Validated
Chromosome2
Chromosomal Location119351229-119354381 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 119353534 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 206 (V206I)
Ref Sequence ENSEMBL: ENSMUSP00000028780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028780]
Predicted Effect probably damaging
Transcript: ENSMUST00000028780
AA Change: V206I

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000028780
Gene: ENSMUSG00000027313
AA Change: V206I

DomainStartEndE-ValueType
low complexity region 5 25 N/A INTRINSIC
Pfam:ChaC 34 209 2.2e-71 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.4%
  • 20x: 94.6%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the gamma-glutamylcyclotransferase family of proteins. The encoded protein has been shown to promote neuronal differentiation by deglycination of the Notch receptor, which prevents receptor maturation and inhibits Notch signaling. This protein may also play a role in the unfolded protein response, and in regulation of glutathione levels and oxidative balance in the cell. Elevated expression of this gene may indicate increased risk of cancer recurrence among breast and ovarian cancer patients. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik C A 16: 88,707,891 R6L unknown Het
Anxa11 A G 14: 25,874,270 Q235R possibly damaging Het
Ap2b1 T A 11: 83,308,239 M1K probably null Het
Atl2 G A 17: 79,850,223 T563I probably benign Het
Azin1 A T 15: 38,492,343 S307R possibly damaging Het
Ccdc153 A G 9: 44,245,780 T118A probably benign Het
Chrm3 A G 13: 9,877,662 V446A probably benign Het
Cped1 T C 6: 22,123,649 F467S probably damaging Het
Csmd3 G A 15: 48,673,560 P82L probably damaging Het
Ddx60 T A 8: 61,977,950 S840T probably benign Het
Ddx60 C T 8: 61,998,681 H1202Y probably benign Het
Dnah8 T A 17: 30,765,635 N3102K probably benign Het
Dst A T 1: 34,116,128 K85M probably damaging Het
Ehbp1l1 T C 19: 5,718,757 I839M probably benign Het
Fam184b T A 5: 45,537,653 M750L probably benign Het
Frem2 T C 3: 53,572,378 T1965A probably benign Het
Ftl1 A T 7: 45,459,210 D41E probably benign Het
Garem2 G A 5: 30,116,737 W698* probably null Het
Glt8d2 T C 10: 82,652,906 Y283C probably damaging Het
Hars T C 18: 36,773,590 E109G possibly damaging Het
Hspb9 T C 11: 100,714,210 S121P probably damaging Het
Hus1b A T 13: 30,947,205 L157Q probably damaging Het
Hykk A G 9: 54,946,359 M322V probably benign Het
Igkv4-61 C A 6: 69,417,154 A31S possibly damaging Het
Il17f T A 1: 20,777,907 M116L probably benign Het
Kif22 T C 7: 127,028,932 K9E possibly damaging Het
Krt90 T C 15: 101,559,244 E233G probably benign Het
Lipg T C 18: 74,957,236 M81V probably benign Het
Mocos C T 18: 24,701,456 S850L probably damaging Het
Mug2 T A 6: 122,082,754 S1364T probably damaging Het
Neb A T 2: 52,185,328 N208K probably benign Het
Oca2 G T 7: 56,328,767 R561L probably benign Het
Olfm5 A G 7: 104,154,053 L401P probably damaging Het
Olfr109 T A 17: 37,467,080 Y291* probably null Het
Olfr1238 C A 2: 89,406,522 A186S possibly damaging Het
Olfr331 T C 11: 58,502,340 D72G probably damaging Het
Olfr828 G A 9: 18,815,892 T134M probably benign Het
Olfr952 T A 9: 39,426,891 Y60F probably damaging Het
Oxgr1 T C 14: 120,022,448 N116D probably damaging Het
Pcdha11 G T 18: 37,012,169 probably null Het
Pi4ka T C 16: 17,358,322 I418V probably benign Het
Pih1d2 T C 9: 50,618,609 V62A probably benign Het
Pkib T A 10: 57,728,138 V46E probably damaging Het
Pum1 A G 4: 130,728,287 probably null Het
Rbak G T 5: 143,176,552 Q19K possibly damaging Het
Sema3c A G 5: 17,576,961 T32A probably damaging Het
Shprh T C 10: 11,167,873 W835R probably damaging Het
Sis T G 3: 72,911,854 K1456N probably damaging Het
Slc4a4 A T 5: 89,179,729 N675I probably benign Het
Slc8a3 C A 12: 81,315,627 M139I probably damaging Het
Sorcs3 T C 19: 48,802,759 F1182S probably damaging Het
St8sia2 A T 7: 73,971,921 I96N probably damaging Het
Stx19 T C 16: 62,822,057 S79P probably damaging Het
Tecta C T 9: 42,375,267 V698M probably damaging Het
Timm22 T C 11: 76,411,139 S150P probably damaging Het
Tjp1 C T 7: 65,313,205 D995N possibly damaging Het
Tmem135 T A 7: 89,147,794 T365S probably benign Het
Tmem174 T C 13: 98,636,981 T114A probably benign Het
Tnc A G 4: 64,007,816 I909T probably benign Het
Trcg1 A G 9: 57,241,330 I62V possibly damaging Het
Tulp1 A T 17: 28,356,031 *487K probably null Het
Unc79 T A 12: 103,131,646 V1826E possibly damaging Het
Vmn2r13 A T 5: 109,174,116 N238K probably damaging Het
Vmn2r22 T A 6: 123,637,738 N298Y probably damaging Het
Vmn2r23 T A 6: 123,712,902 F246I probably damaging Het
Vps9d1 A C 8: 123,248,639 V194G probably damaging Het
Zfp260 A T 7: 30,104,810 H45L possibly damaging Het
Zfp846 A T 9: 20,593,720 H292L possibly damaging Het
Other mutations in Chac1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Chac1 APN 2 119353559 missense probably benign
IGL02611:Chac1 APN 2 119353453 missense probably damaging 1.00
PIT4366001:Chac1 UTSW 2 119351505 missense probably damaging 1.00
R0218:Chac1 UTSW 2 119353460 nonsense probably null
R0862:Chac1 UTSW 2 119353469 missense probably damaging 0.96
R0864:Chac1 UTSW 2 119353469 missense probably damaging 0.96
R1734:Chac1 UTSW 2 119353458 missense probably damaging 1.00
R5398:Chac1 UTSW 2 119353244 missense possibly damaging 0.92
R5609:Chac1 UTSW 2 119351406 missense unknown
R5641:Chac1 UTSW 2 119351518 missense probably damaging 1.00
R7877:Chac1 UTSW 2 119353506 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACAGCACTGGCCTATGTG -3'
(R):5'- TTCAAGTAGTGAGTAAGGGTCAATG -3'

Sequencing Primer
(F):5'- TGGCCACCCCACAGAAC -3'
(R):5'- CTGAAGGCTAGCAGACAGGC -3'
Posted On2018-05-24