Incidental Mutation 'R6416:Sis'
ID 517913
Institutional Source Beutler Lab
Gene Symbol Sis
Ensembl Gene ENSMUSG00000027790
Gene Name sucrase isomaltase (alpha-glucosidase)
Synonyms Si-s, sucrase-isomaltase
MMRRC Submission 044558-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6416 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 72888557-72967863 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 72911854 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 1456 (K1456N)
Ref Sequence ENSEMBL: ENSMUSP00000129116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094190] [ENSMUST00000167334]
AlphaFold F8VQM5
Predicted Effect probably damaging
Transcript: ENSMUST00000094190
AA Change: K1456N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000091742
Gene: ENSMUSG00000027790
AA Change: K1456N

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
PD 51 103 1.92e-12 SMART
Pfam:NtCtMGAM_N 115 224 1.2e-35 PFAM
Pfam:Gal_mutarotas_2 225 294 4.8e-9 PFAM
Pfam:Glyco_hydro_31 314 787 2.1e-142 PFAM
PD 917 972 6.69e-12 SMART
Pfam:NtCtMGAM_N 985 1098 6e-33 PFAM
Blast:ANK 1138 1168 1e-5 BLAST
Pfam:Glyco_hydro_31 1186 1682 8.4e-137 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167334
AA Change: K1456N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000129116
Gene: ENSMUSG00000027790
AA Change: K1456N

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
PD 51 103 1.92e-12 SMART
Pfam:NtCtMGAM_N 115 224 1.2e-35 PFAM
Pfam:Gal_mutarotas_2 225 294 4.8e-9 PFAM
Pfam:Glyco_hydro_31 314 787 2.1e-142 PFAM
PD 917 972 6.69e-12 SMART
Pfam:NtCtMGAM_N 985 1098 6e-33 PFAM
Blast:ANK 1138 1168 1e-5 BLAST
Pfam:Glyco_hydro_31 1186 1682 8.4e-137 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.4%
  • 20x: 94.6%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sucrase-isomaltase enzyme that is expressed in the intestinal brush border. The encoded protein is synthesized as a precursor protein that is cleaved by pancreatic proteases into two enzymatic subunits sucrase and isomaltase. These two subunits heterodimerize to form the sucrose-isomaltase complex. This complex is essential for the digestion of dietary carbohydrates including starch, sucrose and isomaltose. Mutations in this gene are the cause of congenital sucrase-isomaltase deficiency.[provided by RefSeq, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik C A 16: 88,707,891 R6L unknown Het
Anxa11 A G 14: 25,874,270 Q235R possibly damaging Het
Ap2b1 T A 11: 83,308,239 M1K probably null Het
Atl2 G A 17: 79,850,223 T563I probably benign Het
Azin1 A T 15: 38,492,343 S307R possibly damaging Het
Ccdc153 A G 9: 44,245,780 T118A probably benign Het
Chac1 G A 2: 119,353,534 V206I probably damaging Het
Chrm3 A G 13: 9,877,662 V446A probably benign Het
Cped1 T C 6: 22,123,649 F467S probably damaging Het
Csmd3 G A 15: 48,673,560 P82L probably damaging Het
Ddx60 T A 8: 61,977,950 S840T probably benign Het
Ddx60 C T 8: 61,998,681 H1202Y probably benign Het
Dnah8 T A 17: 30,765,635 N3102K probably benign Het
Dst A T 1: 34,116,128 K85M probably damaging Het
Ehbp1l1 T C 19: 5,718,757 I839M probably benign Het
Fam184b T A 5: 45,537,653 M750L probably benign Het
Frem2 T C 3: 53,572,378 T1965A probably benign Het
Ftl1 A T 7: 45,459,210 D41E probably benign Het
Garem2 G A 5: 30,116,737 W698* probably null Het
Glt8d2 T C 10: 82,652,906 Y283C probably damaging Het
Hars T C 18: 36,773,590 E109G possibly damaging Het
Hspb9 T C 11: 100,714,210 S121P probably damaging Het
Hus1b A T 13: 30,947,205 L157Q probably damaging Het
Hykk A G 9: 54,946,359 M322V probably benign Het
Igkv4-61 C A 6: 69,417,154 A31S possibly damaging Het
Il17f T A 1: 20,777,907 M116L probably benign Het
Kif22 T C 7: 127,028,932 K9E possibly damaging Het
Krt90 T C 15: 101,559,244 E233G probably benign Het
Lipg T C 18: 74,957,236 M81V probably benign Het
Mocos C T 18: 24,701,456 S850L probably damaging Het
Mug2 T A 6: 122,082,754 S1364T probably damaging Het
Neb A T 2: 52,185,328 N208K probably benign Het
Oca2 G T 7: 56,328,767 R561L probably benign Het
Olfm5 A G 7: 104,154,053 L401P probably damaging Het
Olfr109 T A 17: 37,467,080 Y291* probably null Het
Olfr1238 C A 2: 89,406,522 A186S possibly damaging Het
Olfr331 T C 11: 58,502,340 D72G probably damaging Het
Olfr828 G A 9: 18,815,892 T134M probably benign Het
Olfr952 T A 9: 39,426,891 Y60F probably damaging Het
Oxgr1 T C 14: 120,022,448 N116D probably damaging Het
Pcdha11 G T 18: 37,012,169 probably null Het
Pi4ka T C 16: 17,358,322 I418V probably benign Het
Pih1d2 T C 9: 50,618,609 V62A probably benign Het
Pkib T A 10: 57,728,138 V46E probably damaging Het
Pum1 A G 4: 130,728,287 probably null Het
Rbak G T 5: 143,176,552 Q19K possibly damaging Het
Sema3c A G 5: 17,576,961 T32A probably damaging Het
Shprh T C 10: 11,167,873 W835R probably damaging Het
Slc4a4 A T 5: 89,179,729 N675I probably benign Het
Slc8a3 C A 12: 81,315,627 M139I probably damaging Het
Sorcs3 T C 19: 48,802,759 F1182S probably damaging Het
St8sia2 A T 7: 73,971,921 I96N probably damaging Het
Stx19 T C 16: 62,822,057 S79P probably damaging Het
Tecta C T 9: 42,375,267 V698M probably damaging Het
Timm22 T C 11: 76,411,139 S150P probably damaging Het
Tjp1 C T 7: 65,313,205 D995N possibly damaging Het
Tmem135 T A 7: 89,147,794 T365S probably benign Het
Tmem174 T C 13: 98,636,981 T114A probably benign Het
Tnc A G 4: 64,007,816 I909T probably benign Het
Trcg1 A G 9: 57,241,330 I62V possibly damaging Het
Tulp1 A T 17: 28,356,031 *487K probably null Het
Unc79 T A 12: 103,131,646 V1826E possibly damaging Het
Vmn2r13 A T 5: 109,174,116 N238K probably damaging Het
Vmn2r22 T A 6: 123,637,738 N298Y probably damaging Het
Vmn2r23 T A 6: 123,712,902 F246I probably damaging Het
Vps9d1 A C 8: 123,248,639 V194G probably damaging Het
Zfp260 A T 7: 30,104,810 H45L possibly damaging Het
Zfp846 A T 9: 20,593,720 H292L possibly damaging Het
Other mutations in Sis
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Sis APN 3 72946636 missense probably benign
IGL00715:Sis APN 3 72934124 missense probably damaging 1.00
IGL00721:Sis APN 3 72943579 missense probably damaging 1.00
IGL00766:Sis APN 3 72907237 splice site probably benign
IGL00783:Sis APN 3 72946632 missense probably benign
IGL00805:Sis APN 3 72934199 missense probably benign 0.05
IGL00932:Sis APN 3 72940956 splice site probably benign
IGL01020:Sis APN 3 72966838 missense probably damaging 1.00
IGL01024:Sis APN 3 72911876 missense probably damaging 1.00
IGL01286:Sis APN 3 72941025 missense probably damaging 1.00
IGL01457:Sis APN 3 72961021 missense probably benign
IGL01514:Sis APN 3 72935920 splice site probably benign
IGL01986:Sis APN 3 72945212 missense probably damaging 1.00
IGL02110:Sis APN 3 72928699 nonsense probably null
IGL02132:Sis APN 3 72947471 missense probably benign 0.00
IGL02152:Sis APN 3 72888986 utr 3 prime probably benign
IGL02200:Sis APN 3 72943604 missense probably damaging 0.99
IGL02244:Sis APN 3 72956190 missense probably benign 0.19
IGL02307:Sis APN 3 72911834 splice site probably benign
IGL02374:Sis APN 3 72925456 missense probably benign 0.03
IGL02437:Sis APN 3 72919614 critical splice acceptor site probably null
IGL02571:Sis APN 3 72956304 splice site probably benign
IGL02601:Sis APN 3 72913210 missense probably benign 0.44
IGL03063:Sis APN 3 72928297 missense probably benign
IGL03382:Sis APN 3 72928719 missense probably benign 0.00
IGL03397:Sis APN 3 72935879 missense probably benign 0.44
PIT1430001:Sis UTSW 3 72922829 missense probably damaging 0.97
R0013:Sis UTSW 3 72910476 missense possibly damaging 0.65
R0013:Sis UTSW 3 72910476 missense possibly damaging 0.65
R0046:Sis UTSW 3 72932094 missense probably benign 0.01
R0094:Sis UTSW 3 72921437 missense probably damaging 1.00
R0096:Sis UTSW 3 72928267 missense probably damaging 1.00
R0505:Sis UTSW 3 72960296 missense probably benign 0.29
R0544:Sis UTSW 3 72951642 missense probably damaging 1.00
R0551:Sis UTSW 3 72925407 missense possibly damaging 0.79
R0617:Sis UTSW 3 72965605 missense probably damaging 1.00
R0698:Sis UTSW 3 72910498 missense probably damaging 1.00
R0701:Sis UTSW 3 72941045 missense probably damaging 1.00
R0704:Sis UTSW 3 72949822 missense possibly damaging 0.63
R0706:Sis UTSW 3 72952531 missense probably damaging 1.00
R0710:Sis UTSW 3 72952531 missense probably damaging 1.00
R0752:Sis UTSW 3 72952531 missense probably damaging 1.00
R0753:Sis UTSW 3 72952531 missense probably damaging 1.00
R0754:Sis UTSW 3 72952531 missense probably damaging 1.00
R0767:Sis UTSW 3 72952531 missense probably damaging 1.00
R0769:Sis UTSW 3 72952531 missense probably damaging 1.00
R0772:Sis UTSW 3 72952531 missense probably damaging 1.00
R0774:Sis UTSW 3 72952531 missense probably damaging 1.00
R0776:Sis UTSW 3 72952531 missense probably damaging 1.00
R0818:Sis UTSW 3 72952531 missense probably damaging 1.00
R0819:Sis UTSW 3 72952531 missense probably damaging 1.00
R0885:Sis UTSW 3 72911949 nonsense probably null
R1076:Sis UTSW 3 72934098 missense probably damaging 0.97
R1140:Sis UTSW 3 72951616 missense probably damaging 0.98
R1175:Sis UTSW 3 72958104 splice site probably benign
R1301:Sis UTSW 3 72946582 missense possibly damaging 0.76
R1437:Sis UTSW 3 72934142 missense probably damaging 1.00
R1466:Sis UTSW 3 72932060 missense possibly damaging 0.60
R1466:Sis UTSW 3 72932060 missense possibly damaging 0.60
R1472:Sis UTSW 3 72889027 missense probably benign 0.12
R1584:Sis UTSW 3 72932060 missense possibly damaging 0.60
R1707:Sis UTSW 3 72909087 splice site probably benign
R1715:Sis UTSW 3 72889010 missense possibly damaging 0.47
R1719:Sis UTSW 3 72965604 missense probably damaging 1.00
R1728:Sis UTSW 3 72965645 nonsense probably null
R1784:Sis UTSW 3 72965645 nonsense probably null
R1820:Sis UTSW 3 72921142 missense probably damaging 1.00
R1972:Sis UTSW 3 72921004 missense probably damaging 1.00
R1973:Sis UTSW 3 72921004 missense probably damaging 1.00
R2054:Sis UTSW 3 72913237 missense probably benign 0.01
R2233:Sis UTSW 3 72913194 missense probably benign 0.03
R2235:Sis UTSW 3 72913194 missense probably benign 0.03
R2276:Sis UTSW 3 72914601 nonsense probably null
R2435:Sis UTSW 3 72911904 missense probably benign 0.01
R2885:Sis UTSW 3 72909173 missense probably benign 0.01
R2966:Sis UTSW 3 72889010 missense probably benign 0.30
R3708:Sis UTSW 3 72943523 missense probably benign 0.02
R3790:Sis UTSW 3 72921414 missense probably damaging 1.00
R3807:Sis UTSW 3 72925596 missense probably benign 0.01
R3858:Sis UTSW 3 72928652 missense probably damaging 0.99
R3974:Sis UTSW 3 72943635 missense probably damaging 0.96
R3975:Sis UTSW 3 72943635 missense probably damaging 0.96
R4037:Sis UTSW 3 72928602 missense probably benign
R4080:Sis UTSW 3 72921184 missense probably damaging 1.00
R4204:Sis UTSW 3 72961082 missense probably benign
R4394:Sis UTSW 3 72956149 missense probably damaging 1.00
R4470:Sis UTSW 3 72928159 splice site probably null
R4573:Sis UTSW 3 72928237 missense possibly damaging 0.94
R4868:Sis UTSW 3 72943548 missense probably benign 0.09
R5023:Sis UTSW 3 72934122 missense probably benign 0.05
R5264:Sis UTSW 3 72949756 missense probably damaging 0.98
R5414:Sis UTSW 3 72952493 missense probably benign
R5462:Sis UTSW 3 72949838 missense probably damaging 0.96
R5523:Sis UTSW 3 72891421 missense probably benign 0.00
R5584:Sis UTSW 3 72910415 missense probably damaging 1.00
R5587:Sis UTSW 3 72914576 missense possibly damaging 0.94
R5725:Sis UTSW 3 72965598 missense probably damaging 1.00
R5769:Sis UTSW 3 72928235 missense probably damaging 0.98
R5790:Sis UTSW 3 72928174 missense probably benign
R5864:Sis UTSW 3 72949818 missense probably damaging 1.00
R5902:Sis UTSW 3 72960256 critical splice donor site probably null
R5925:Sis UTSW 3 72921380 splice site probably null
R6018:Sis UTSW 3 72913192 missense possibly damaging 0.95
R6029:Sis UTSW 3 72928308 missense probably benign 0.30
R6124:Sis UTSW 3 72953211 missense possibly damaging 0.69
R6171:Sis UTSW 3 72961027 missense possibly damaging 0.75
R6182:Sis UTSW 3 72904293 missense probably benign 0.05
R6295:Sis UTSW 3 72966770 missense probably damaging 0.99
R6431:Sis UTSW 3 72958174 missense probably benign 0.00
R6472:Sis UTSW 3 72938734 nonsense probably null
R6517:Sis UTSW 3 72907142 missense probably damaging 1.00
R6701:Sis UTSW 3 72949527 missense probably damaging 1.00
R6796:Sis UTSW 3 72965618 missense probably benign 0.06
R6853:Sis UTSW 3 72891426 missense possibly damaging 0.93
R6906:Sis UTSW 3 72919485 missense probably damaging 1.00
R7058:Sis UTSW 3 72903607 missense probably damaging 0.98
R7357:Sis UTSW 3 72925071 missense probably damaging 1.00
R7381:Sis UTSW 3 72913292 splice site probably null
R7439:Sis UTSW 3 72909041 missense possibly damaging 0.81
R7742:Sis UTSW 3 72925098 missense probably benign 0.19
R7813:Sis UTSW 3 72925468 missense probably benign 0.01
R7883:Sis UTSW 3 72920996 missense possibly damaging 0.78
R7899:Sis UTSW 3 72937251 missense probably damaging 1.00
R7915:Sis UTSW 3 72921138 missense probably damaging 0.99
R7985:Sis UTSW 3 72936961 splice site probably null
R8020:Sis UTSW 3 72908965 critical splice donor site probably null
R8023:Sis UTSW 3 72952480 missense probably damaging 0.97
R8029:Sis UTSW 3 72921142 missense probably damaging 1.00
R8053:Sis UTSW 3 72949568 nonsense probably null
R8062:Sis UTSW 3 72920988 nonsense probably null
R8074:Sis UTSW 3 72917198 missense probably damaging 1.00
R8085:Sis UTSW 3 72907129 missense probably damaging 1.00
R8137:Sis UTSW 3 72889045 missense probably benign 0.22
R8349:Sis UTSW 3 72903651 missense probably damaging 1.00
R8354:Sis UTSW 3 72947501 missense possibly damaging 0.84
R8366:Sis UTSW 3 72958233 missense probably damaging 1.00
R8449:Sis UTSW 3 72903651 missense probably damaging 1.00
R8454:Sis UTSW 3 72947501 missense possibly damaging 0.84
R8474:Sis UTSW 3 72929397 missense probably damaging 1.00
R8515:Sis UTSW 3 72929409 missense probably benign 0.00
R8680:Sis UTSW 3 72960295 missense probably damaging 1.00
R8703:Sis UTSW 3 72960324 missense probably damaging 1.00
R9098:Sis UTSW 3 72937245 missense possibly damaging 0.66
R9466:Sis UTSW 3 72965577 critical splice donor site probably null
R9574:Sis UTSW 3 72921157 missense probably benign 0.05
R9630:Sis UTSW 3 72921389 missense probably benign 0.11
R9680:Sis UTSW 3 72956288 missense probably benign 0.12
R9709:Sis UTSW 3 72891741 missense possibly damaging 0.47
R9731:Sis UTSW 3 72928210 missense probably benign 0.01
X0009:Sis UTSW 3 72889022 missense probably damaging 0.99
X0024:Sis UTSW 3 72928670 missense probably benign
X0060:Sis UTSW 3 72920906 intron probably benign
Z1176:Sis UTSW 3 72904273 missense probably benign 0.05
Z1176:Sis UTSW 3 72943557 missense probably benign 0.25
Z1177:Sis UTSW 3 72909172 missense possibly damaging 0.88
Z1177:Sis UTSW 3 72910474 missense probably damaging 1.00
Z1177:Sis UTSW 3 72943569 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCGATTGCTTACCTGATTG -3'
(R):5'- CCGCGTTCATTAGTATCCAGC -3'

Sequencing Primer
(F):5'- GGAAAGAAACTCCTCAAGATTC -3'
(R):5'- CGTTCATTAGTATCCAGCTATTCATG -3'
Posted On 2018-05-24