Incidental Mutation 'R6416:Vmn2r13'
ID 517919
Institutional Source Beutler Lab
Gene Symbol Vmn2r13
Ensembl Gene ENSMUSG00000091635
Gene Name vomeronasal 2, receptor 13
Synonyms Gm4867
MMRRC Submission 044558-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.073) question?
Stock # R6416 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 109156068-109192107 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 109174116 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 238 (N238K)
Ref Sequence ENSEMBL: ENSMUSP00000052977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053253]
AlphaFold L7N1X2
Predicted Effect probably damaging
Transcript: ENSMUST00000053253
AA Change: N238K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000052977
Gene: ENSMUSG00000091635
AA Change: N238K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 76 463 2.8e-29 PFAM
Pfam:NCD3G 506 560 1.3e-18 PFAM
Pfam:7tm_3 593 828 1.8e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.4%
  • 20x: 94.6%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik C A 16: 88,707,891 (GRCm38) R6L unknown Het
Anxa11 A G 14: 25,874,270 (GRCm38) Q235R possibly damaging Het
Ap2b1 T A 11: 83,308,239 (GRCm38) M1K probably null Het
Atl2 G A 17: 79,850,223 (GRCm38) T563I probably benign Het
Azin1 A T 15: 38,492,343 (GRCm38) S307R possibly damaging Het
Ccdc153 A G 9: 44,245,780 (GRCm38) T118A probably benign Het
Chac1 G A 2: 119,353,534 (GRCm38) V206I probably damaging Het
Chrm3 A G 13: 9,877,662 (GRCm38) V446A probably benign Het
Cped1 T C 6: 22,123,649 (GRCm38) F467S probably damaging Het
Csmd3 G A 15: 48,673,560 (GRCm38) P82L probably damaging Het
Ddx60 C T 8: 61,998,681 (GRCm38) H1202Y probably benign Het
Ddx60 T A 8: 61,977,950 (GRCm38) S840T probably benign Het
Dnah8 T A 17: 30,765,635 (GRCm38) N3102K probably benign Het
Dst A T 1: 34,116,128 (GRCm38) K85M probably damaging Het
Ehbp1l1 T C 19: 5,718,757 (GRCm38) I839M probably benign Het
Fam184b T A 5: 45,537,653 (GRCm38) M750L probably benign Het
Frem2 T C 3: 53,572,378 (GRCm38) T1965A probably benign Het
Ftl1 A T 7: 45,459,210 (GRCm38) D41E probably benign Het
Garem2 G A 5: 30,116,737 (GRCm38) W698* probably null Het
Glt8d2 T C 10: 82,652,906 (GRCm38) Y283C probably damaging Het
Hars T C 18: 36,773,590 (GRCm38) E109G possibly damaging Het
Hspb9 T C 11: 100,714,210 (GRCm38) S121P probably damaging Het
Hus1b A T 13: 30,947,205 (GRCm38) L157Q probably damaging Het
Hykk A G 9: 54,946,359 (GRCm38) M322V probably benign Het
Igkv4-61 C A 6: 69,417,154 (GRCm38) A31S possibly damaging Het
Il17f T A 1: 20,777,907 (GRCm38) M116L probably benign Het
Kif22 T C 7: 127,028,932 (GRCm38) K9E possibly damaging Het
Krt90 T C 15: 101,559,244 (GRCm38) E233G probably benign Het
Lipg T C 18: 74,957,236 (GRCm38) M81V probably benign Het
Mocos C T 18: 24,701,456 (GRCm38) S850L probably damaging Het
Mug2 T A 6: 122,082,754 (GRCm38) S1364T probably damaging Het
Neb A T 2: 52,185,328 (GRCm38) N208K probably benign Het
Oca2 G T 7: 56,328,767 (GRCm38) R561L probably benign Het
Olfm5 A G 7: 104,154,053 (GRCm38) L401P probably damaging Het
Olfr109 T A 17: 37,467,080 (GRCm38) Y291* probably null Het
Olfr1238 C A 2: 89,406,522 (GRCm38) A186S possibly damaging Het
Olfr331 T C 11: 58,502,340 (GRCm38) D72G probably damaging Het
Olfr828 G A 9: 18,815,892 (GRCm38) T134M probably benign Het
Olfr952 T A 9: 39,426,891 (GRCm38) Y60F probably damaging Het
Oxgr1 T C 14: 120,022,448 (GRCm38) N116D probably damaging Het
Pcdha11 G T 18: 37,012,169 (GRCm38) probably null Het
Pi4ka T C 16: 17,358,322 (GRCm38) I418V probably benign Het
Pih1d2 T C 9: 50,618,609 (GRCm38) V62A probably benign Het
Pkib T A 10: 57,728,138 (GRCm38) V46E probably damaging Het
Pum1 A G 4: 130,728,287 (GRCm38) probably null Het
Rbak G T 5: 143,176,552 (GRCm38) Q19K possibly damaging Het
Sema3c A G 5: 17,576,961 (GRCm38) T32A probably damaging Het
Shprh T C 10: 11,167,873 (GRCm38) W835R probably damaging Het
Sis T G 3: 72,911,854 (GRCm38) K1456N probably damaging Het
Slc4a4 A T 5: 89,179,729 (GRCm38) N675I probably benign Het
Slc8a3 C A 12: 81,315,627 (GRCm38) M139I probably damaging Het
Sorcs3 T C 19: 48,802,759 (GRCm38) F1182S probably damaging Het
St8sia2 A T 7: 73,971,921 (GRCm38) I96N probably damaging Het
Stx19 T C 16: 62,822,057 (GRCm38) S79P probably damaging Het
Tecta C T 9: 42,375,267 (GRCm38) V698M probably damaging Het
Timm22 T C 11: 76,411,139 (GRCm38) S150P probably damaging Het
Tjp1 C T 7: 65,313,205 (GRCm38) D995N possibly damaging Het
Tmem135 T A 7: 89,147,794 (GRCm38) T365S probably benign Het
Tmem174 T C 13: 98,636,981 (GRCm38) T114A probably benign Het
Tnc A G 4: 64,007,816 (GRCm38) I909T probably benign Het
Trcg1 A G 9: 57,241,330 (GRCm38) I62V possibly damaging Het
Tulp1 A T 17: 28,356,031 (GRCm38) *487K probably null Het
Unc79 T A 12: 103,131,646 (GRCm38) V1826E possibly damaging Het
Vmn2r22 T A 6: 123,637,738 (GRCm38) N298Y probably damaging Het
Vmn2r23 T A 6: 123,712,902 (GRCm38) F246I probably damaging Het
Vps9d1 A C 8: 123,248,639 (GRCm38) V194G probably damaging Het
Zfp260 A T 7: 30,104,810 (GRCm38) H45L possibly damaging Het
Zfp846 A T 9: 20,593,720 (GRCm38) H292L possibly damaging Het
Other mutations in Vmn2r13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Vmn2r13 APN 5 109,156,098 (GRCm38) missense probably damaging 1.00
IGL01373:Vmn2r13 APN 5 109,156,702 (GRCm38) missense probably damaging 1.00
IGL01946:Vmn2r13 APN 5 109,174,219 (GRCm38) missense probably benign 0.01
IGL01971:Vmn2r13 APN 5 109,174,115 (GRCm38) missense probably benign 0.01
IGL02636:Vmn2r13 APN 5 109,192,017 (GRCm38) missense probably damaging 0.98
IGL03062:Vmn2r13 APN 5 109,156,282 (GRCm38) missense probably damaging 1.00
IGL03173:Vmn2r13 APN 5 109,171,779 (GRCm38) missense possibly damaging 0.95
IGL03301:Vmn2r13 APN 5 109,158,089 (GRCm38) missense probably damaging 0.99
IGL03383:Vmn2r13 APN 5 109,156,532 (GRCm38) missense probably damaging 0.98
IGL03048:Vmn2r13 UTSW 5 109,156,285 (GRCm38) missense probably damaging 1.00
R0123:Vmn2r13 UTSW 5 109,175,049 (GRCm38) missense probably benign 0.00
R0134:Vmn2r13 UTSW 5 109,175,049 (GRCm38) missense probably benign 0.00
R0220:Vmn2r13 UTSW 5 109,156,466 (GRCm38) missense probably damaging 1.00
R0225:Vmn2r13 UTSW 5 109,175,049 (GRCm38) missense probably benign 0.00
R0393:Vmn2r13 UTSW 5 109,156,529 (GRCm38) missense probably benign 0.01
R0410:Vmn2r13 UTSW 5 109,173,813 (GRCm38) missense probably benign 0.35
R0787:Vmn2r13 UTSW 5 109,156,847 (GRCm38) missense probably damaging 0.99
R1200:Vmn2r13 UTSW 5 109,174,202 (GRCm38) missense probably damaging 1.00
R1448:Vmn2r13 UTSW 5 109,174,135 (GRCm38) missense probably damaging 1.00
R1782:Vmn2r13 UTSW 5 109,158,174 (GRCm38) missense probably benign 0.08
R1939:Vmn2r13 UTSW 5 109,191,986 (GRCm38) missense possibly damaging 0.88
R2029:Vmn2r13 UTSW 5 109,192,077 (GRCm38) missense probably benign 0.13
R2125:Vmn2r13 UTSW 5 109,158,192 (GRCm38) missense probably benign 0.00
R2126:Vmn2r13 UTSW 5 109,158,192 (GRCm38) missense probably benign 0.00
R2379:Vmn2r13 UTSW 5 109,171,778 (GRCm38) missense probably benign 0.05
R2680:Vmn2r13 UTSW 5 109,174,312 (GRCm38) missense possibly damaging 0.66
R2888:Vmn2r13 UTSW 5 109,191,974 (GRCm38) missense possibly damaging 0.88
R2889:Vmn2r13 UTSW 5 109,191,974 (GRCm38) missense possibly damaging 0.88
R2890:Vmn2r13 UTSW 5 109,191,974 (GRCm38) missense possibly damaging 0.88
R3014:Vmn2r13 UTSW 5 109,171,761 (GRCm38) missense possibly damaging 0.81
R3683:Vmn2r13 UTSW 5 109,156,855 (GRCm38) missense probably damaging 1.00
R4074:Vmn2r13 UTSW 5 109,156,700 (GRCm38) missense probably damaging 1.00
R4599:Vmn2r13 UTSW 5 109,156,456 (GRCm38) missense probably damaging 1.00
R4614:Vmn2r13 UTSW 5 109,175,199 (GRCm38) missense probably benign 0.01
R4805:Vmn2r13 UTSW 5 109,156,465 (GRCm38) missense probably damaging 1.00
R4822:Vmn2r13 UTSW 5 109,174,072 (GRCm38) missense probably damaging 0.99
R4943:Vmn2r13 UTSW 5 109,175,049 (GRCm38) missense probably benign 0.00
R5263:Vmn2r13 UTSW 5 109,173,975 (GRCm38) missense probably benign 0.00
R5297:Vmn2r13 UTSW 5 109,191,939 (GRCm38) missense probably benign 0.00
R5502:Vmn2r13 UTSW 5 109,173,714 (GRCm38) missense probably damaging 1.00
R5554:Vmn2r13 UTSW 5 109,191,994 (GRCm38) missense possibly damaging 0.49
R5563:Vmn2r13 UTSW 5 109,173,980 (GRCm38) missense probably benign 0.00
R5819:Vmn2r13 UTSW 5 109,174,100 (GRCm38) missense possibly damaging 0.79
R6074:Vmn2r13 UTSW 5 109,174,301 (GRCm38) missense probably benign 0.04
R6419:Vmn2r13 UTSW 5 109,175,219 (GRCm38) missense possibly damaging 0.87
R6484:Vmn2r13 UTSW 5 109,156,674 (GRCm38) nonsense probably null
R6486:Vmn2r13 UTSW 5 109,156,559 (GRCm38) missense probably benign 0.05
R6545:Vmn2r13 UTSW 5 109,156,940 (GRCm38) splice site probably null
R6700:Vmn2r13 UTSW 5 109,175,072 (GRCm38) missense probably benign 0.00
R6897:Vmn2r13 UTSW 5 109,158,149 (GRCm38) missense possibly damaging 0.90
R6957:Vmn2r13 UTSW 5 109,156,887 (GRCm38) nonsense probably null
R7276:Vmn2r13 UTSW 5 109,173,779 (GRCm38) missense probably damaging 1.00
R7363:Vmn2r13 UTSW 5 109,192,043 (GRCm38) missense probably benign 0.03
R7443:Vmn2r13 UTSW 5 109,192,043 (GRCm38) missense probably benign 0.03
R7555:Vmn2r13 UTSW 5 109,171,691 (GRCm38) splice site probably null
R7607:Vmn2r13 UTSW 5 109,173,640 (GRCm38) missense probably damaging 0.98
R7719:Vmn2r13 UTSW 5 109,171,752 (GRCm38) missense probably benign 0.00
R8116:Vmn2r13 UTSW 5 109,175,060 (GRCm38) missense probably benign 0.12
R8242:Vmn2r13 UTSW 5 109,175,006 (GRCm38) missense possibly damaging 0.65
R8294:Vmn2r13 UTSW 5 109,175,112 (GRCm38) missense probably benign 0.02
R8340:Vmn2r13 UTSW 5 109,174,140 (GRCm38) missense probably benign 0.00
R8692:Vmn2r13 UTSW 5 109,171,648 (GRCm38) missense probably benign 0.03
R8742:Vmn2r13 UTSW 5 109,156,397 (GRCm38) missense probably benign 0.02
R9022:Vmn2r13 UTSW 5 109,156,376 (GRCm38) missense possibly damaging 0.94
R9281:Vmn2r13 UTSW 5 109,156,087 (GRCm38) missense probably damaging 1.00
R9529:Vmn2r13 UTSW 5 109,156,198 (GRCm38) missense probably damaging 1.00
R9708:Vmn2r13 UTSW 5 109,174,141 (GRCm38) missense probably benign 0.00
R9746:Vmn2r13 UTSW 5 109,191,907 (GRCm38) critical splice donor site probably null
X0066:Vmn2r13 UTSW 5 109,156,219 (GRCm38) missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- ACAACATCCCATTGTGAGGTTG -3'
(R):5'- ATCCTAAGCTGAGTGACCATG -3'

Sequencing Primer
(F):5'- CAACATCCCATTGTGAGGTTGTGATC -3'
(R):5'- AGCTGAGTGACCATGACCAGTTTC -3'
Posted On 2018-05-24