Mutagenetix > Incidental Mutation

Incidental Mutation 'R6416:Vmn2r23'

517925

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r23

Ensembl Gene

ENSMUSG00000091620

Gene Name

vomeronasal 2, receptor 23

Synonyms

EG435916

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.062) question?

Stock #

R6416 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

123702821-123742291 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 123712902 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 246 (F246I)

Ref Sequence

ENSEMBL: ENSMUSP00000126682 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000172391]

AlphaFold

E9PXI5

Predicted Effect

probably damaging
Transcript: ENSMUST00000172391
AA Change: F246I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: F246I

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:ANF_receptor	79	461	1.7e-31	PFAM
Pfam:NCD3G	513	566	1.2e-23	PFAM
Pfam:7tm_3	596	834	1.5e-55	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.8%
10x: 98.4%
20x: 94.6%

Validation Efficiency

99% (67/68)

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310061N02Rik	C	A	16: 88,707,891	R6L	unknown	Het
Anxa11	A	G	14: 25,874,270	Q235R	possibly damaging	Het
Ap2b1	T	A	11: 83,308,239	M1K	probably null	Het
Atl2	G	A	17: 79,850,223	T563I	probably benign	Het
Azin1	A	T	15: 38,492,343	S307R	possibly damaging	Het
Ccdc153	A	G	9: 44,245,780	T118A	probably benign	Het
Chac1	G	A	2: 119,353,534	V206I	probably damaging	Het
Chrm3	A	G	13: 9,877,662	V446A	probably benign	Het
Cped1	T	C	6: 22,123,649	F467S	probably damaging	Het
Csmd3	G	A	15: 48,673,560	P82L	probably damaging	Het
Ddx60	T	A	8: 61,977,950	S840T	probably benign	Het
Ddx60	C	T	8: 61,998,681	H1202Y	probably benign	Het
Dnah8	T	A	17: 30,765,635	N3102K	probably benign	Het
Dst	A	T	1: 34,116,128	K85M	probably damaging	Het
Ehbp1l1	T	C	19: 5,718,757	I839M	probably benign	Het
Fam184b	T	A	5: 45,537,653	M750L	probably benign	Het
Frem2	T	C	3: 53,572,378	T1965A	probably benign	Het
Ftl1	A	T	7: 45,459,210	D41E	probably benign	Het
Garem2	G	A	5: 30,116,737	W698*	probably null	Het
Glt8d2	T	C	10: 82,652,906	Y283C	probably damaging	Het
Hars	T	C	18: 36,773,590	E109G	possibly damaging	Het
Hspb9	T	C	11: 100,714,210	S121P	probably damaging	Het
Hus1b	A	T	13: 30,947,205	L157Q	probably damaging	Het
Hykk	A	G	9: 54,946,359	M322V	probably benign	Het
Igkv4-61	C	A	6: 69,417,154	A31S	possibly damaging	Het
Il17f	T	A	1: 20,777,907	M116L	probably benign	Het
Kif22	T	C	7: 127,028,932	K9E	possibly damaging	Het
Krt90	T	C	15: 101,559,244	E233G	probably benign	Het
Lipg	T	C	18: 74,957,236	M81V	probably benign	Het
Mocos	C	T	18: 24,701,456	S850L	probably damaging	Het
Mug2	T	A	6: 122,082,754	S1364T	probably damaging	Het
Neb	A	T	2: 52,185,328	N208K	probably benign	Het
Oca2	G	T	7: 56,328,767	R561L	probably benign	Het
Olfm5	A	G	7: 104,154,053	L401P	probably damaging	Het
Olfr109	T	A	17: 37,467,080	Y291*	probably null	Het
Olfr1238	C	A	2: 89,406,522	A186S	possibly damaging	Het
Olfr331	T	C	11: 58,502,340	D72G	probably damaging	Het
Olfr828	G	A	9: 18,815,892	T134M	probably benign	Het
Olfr952	T	A	9: 39,426,891	Y60F	probably damaging	Het
Oxgr1	T	C	14: 120,022,448	N116D	probably damaging	Het
Pcdha11	G	T	18: 37,012,169		probably null	Het
Pi4ka	T	C	16: 17,358,322	I418V	probably benign	Het
Pih1d2	T	C	9: 50,618,609	V62A	probably benign	Het
Pkib	T	A	10: 57,728,138	V46E	probably damaging	Het
Pum1	A	G	4: 130,728,287		probably null	Het
Rbak	G	T	5: 143,176,552	Q19K	possibly damaging	Het
Sema3c	A	G	5: 17,576,961	T32A	probably damaging	Het
Shprh	T	C	10: 11,167,873	W835R	probably damaging	Het
Sis	T	G	3: 72,911,854	K1456N	probably damaging	Het
Slc4a4	A	T	5: 89,179,729	N675I	probably benign	Het
Slc8a3	C	A	12: 81,315,627	M139I	probably damaging	Het
Sorcs3	T	C	19: 48,802,759	F1182S	probably damaging	Het
St8sia2	A	T	7: 73,971,921	I96N	probably damaging	Het
Stx19	T	C	16: 62,822,057	S79P	probably damaging	Het
Tecta	C	T	9: 42,375,267	V698M	probably damaging	Het
Timm22	T	C	11: 76,411,139	S150P	probably damaging	Het
Tjp1	C	T	7: 65,313,205	D995N	possibly damaging	Het
Tmem135	T	A	7: 89,147,794	T365S	probably benign	Het
Tmem174	T	C	13: 98,636,981	T114A	probably benign	Het
Tnc	A	G	4: 64,007,816	I909T	probably benign	Het
Trcg1	A	G	9: 57,241,330	I62V	possibly damaging	Het
Tulp1	A	T	17: 28,356,031	*487K	probably null	Het
Unc79	T	A	12: 103,131,646	V1826E	possibly damaging	Het
Vmn2r13	A	T	5: 109,174,116	N238K	probably damaging	Het
Vmn2r22	T	A	6: 123,637,738	N298Y	probably damaging	Het
Vps9d1	A	C	8: 123,248,639	V194G	probably damaging	Het
Zfp260	A	T	7: 30,104,810	H45L	possibly damaging	Het
Zfp846	A	T	9: 20,593,720	H292L	possibly damaging	Het

Other mutations in Vmn2r23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Vmn2r23	APN	6	123729725	missense	possibly damaging	0.89
IGL01012:Vmn2r23	APN	6	123729596	missense	probably benign
IGL01073:Vmn2r23	APN	6	123712800	missense	possibly damaging	0.82
IGL01547:Vmn2r23	APN	6	123704424	missense	possibly damaging	0.88
IGL01571:Vmn2r23	APN	6	123704407	missense	probably damaging	1.00
IGL01950:Vmn2r23	APN	6	123741886	missense	possibly damaging	0.80
IGL02028:Vmn2r23	APN	6	123741860	missense	probably damaging	1.00
IGL02248:Vmn2r23	APN	6	123741744	missense	probably damaging	0.96
IGL02318:Vmn2r23	APN	6	123741836	missense	probably benign	0.10
IGL02649:Vmn2r23	APN	6	123704478	missense	probably benign
IGL02831:Vmn2r23	APN	6	123704385	missense	probably benign	0.22
IGL02832:Vmn2r23	APN	6	123704396	missense	probably benign	0.00
IGL02865:Vmn2r23	APN	6	123741619	missense	probably damaging	1.00
IGL02964:Vmn2r23	APN	6	123741782	missense	possibly damaging	0.93
IGL03347:Vmn2r23	APN	6	123704374	missense	probably benign	0.01
IGL03396:Vmn2r23	APN	6	123729626	missense	probably damaging	1.00
PIT4472001:Vmn2r23	UTSW	6	123712977	missense	possibly damaging	0.62
R0597:Vmn2r23	UTSW	6	123729721	missense	probably benign	0.08
R0677:Vmn2r23	UTSW	6	123713451	missense	probably benign	0.00
R0904:Vmn2r23	UTSW	6	123742135	missense	probably damaging	1.00
R1330:Vmn2r23	UTSW	6	123742004	missense	probably damaging	1.00
R1424:Vmn2r23	UTSW	6	123713270	nonsense	probably null
R1629:Vmn2r23	UTSW	6	123713427	missense	probably benign	0.05
R1842:Vmn2r23	UTSW	6	123729690	missense	possibly damaging	0.77
R1867:Vmn2r23	UTSW	6	123702915	missense	probably damaging	1.00
R1919:Vmn2r23	UTSW	6	123713010	missense	possibly damaging	0.94
R2087:Vmn2r23	UTSW	6	123741499	missense	probably benign	0.00
R2338:Vmn2r23	UTSW	6	123704425	missense	possibly damaging	0.88
R2568:Vmn2r23	UTSW	6	123742188	nonsense	probably null
R2867:Vmn2r23	UTSW	6	123713164	missense	possibly damaging	0.94
R2867:Vmn2r23	UTSW	6	123713164	missense	possibly damaging	0.94
R3500:Vmn2r23	UTSW	6	123713170	missense	possibly damaging	0.81
R3789:Vmn2r23	UTSW	6	123741389	missense	probably damaging	1.00
R4164:Vmn2r23	UTSW	6	123729738	missense	probably benign
R4506:Vmn2r23	UTSW	6	123702925	missense	probably damaging	1.00
R4652:Vmn2r23	UTSW	6	123741730	missense	probably damaging	1.00
R4697:Vmn2r23	UTSW	6	123741826	missense	probably damaging	1.00
R4840:Vmn2r23	UTSW	6	123713074	missense	probably damaging	1.00
R4983:Vmn2r23	UTSW	6	123733349	missense	probably damaging	1.00
R5276:Vmn2r23	UTSW	6	123712977	missense	possibly damaging	0.62
R5392:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R5528:Vmn2r23	UTSW	6	123713002	missense	probably damaging	1.00
R5529:Vmn2r23	UTSW	6	123713451	missense	probably benign	0.00
R5664:Vmn2r23	UTSW	6	123713074	missense	probably damaging	1.00
R5749:Vmn2r23	UTSW	6	123733273	missense	probably benign
R5761:Vmn2r23	UTSW	6	123712759	missense	probably benign	0.39
R5762:Vmn2r23	UTSW	6	123733393	missense	probably damaging	1.00
R5868:Vmn2r23	UTSW	6	123712942	missense	probably benign	0.12
R5935:Vmn2r23	UTSW	6	123741895	missense	possibly damaging	0.94
R6242:Vmn2r23	UTSW	6	123704400	missense	possibly damaging	0.82
R6524:Vmn2r23	UTSW	6	123713425	missense	probably damaging	1.00
R6576:Vmn2r23	UTSW	6	123733273	missense	probably benign
R6925:Vmn2r23	UTSW	6	123704553	missense	probably damaging	1.00
R7148:Vmn2r23	UTSW	6	123713022	missense	probably benign
R7215:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R7252:Vmn2r23	UTSW	6	123741581	missense	probably damaging	0.97
R7403:Vmn2r23	UTSW	6	123704579	missense	probably benign	0.01
R8015:Vmn2r23	UTSW	6	123704541	missense	probably benign	0.00
R8143:Vmn2r23	UTSW	6	123741353	missense	probably damaging	0.99
R8474:Vmn2r23	UTSW	6	123704640	missense	probably benign	0.36
R8520:Vmn2r23	UTSW	6	123741656	missense	probably damaging	0.99
R8679:Vmn2r23	UTSW	6	123713472	missense	probably damaging	0.99
R8713:Vmn2r23	UTSW	6	123703032	missense
R8966:Vmn2r23	UTSW	6	123742120	missense	possibly damaging	0.94
R9124:Vmn2r23	UTSW	6	123742079	missense	possibly damaging	0.57
R9163:Vmn2r23	UTSW	6	123741823	missense	probably damaging	1.00
R9189:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R9451:Vmn2r23	UTSW	6	123733393	missense	probably damaging	1.00
R9495:Vmn2r23	UTSW	6	123712713	missense	probably benign	0.30
R9514:Vmn2r23	UTSW	6	123712713	missense	probably benign	0.30
RF018:Vmn2r23	UTSW	6	123713116	missense	probably benign	0.00
T0975:Vmn2r23	UTSW	6	123713161	missense	probably benign	0.00
Z1088:Vmn2r23	UTSW	6	123742108	missense	probably damaging	0.98
Z1177:Vmn2r23	UTSW	6	123729725	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- CTTTTGACCACAGTCTTGGGAC -3'
(R):5'- GTGATATCCCAATCAGACGTTGTG -3'

Sequencing Primer
(F):5'- ACAGTCTTGGGACCAGAGTC -3'
(R):5'- TATCCCAATCAGACGTTGTGATCCAG -3'

Posted On

2018-05-24