Incidental Mutation 'R6416:St8sia2'
ID 517930
Institutional Source Beutler Lab
Gene Symbol St8sia2
Ensembl Gene ENSMUSG00000025789
Gene Name ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2
Synonyms Siat8b, ST8SiaII
MMRRC Submission 044558-MU
Accession Numbers

Ncbi RefSeq: NM_009181.2; MGI:106020
Essential gene? Probably non essential (E-score: 0.116) question?
Stock # R6416 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 73939119-74013690 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 73971921 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 96 (I96N)
Ref Sequence ENSEMBL: ENSMUSP00000026896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026896] [ENSMUST00000191970]
AlphaFold O35696
Predicted Effect probably damaging
Transcript: ENSMUST00000026896
AA Change: I96N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000026896
Gene: ENSMUSG00000025789
AA Change: I96N

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 25 39 N/A INTRINSIC
Pfam:Glyco_transf_29 109 369 2.7e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191970
AA Change: I75N

PolyPhen 2 Score 0.200 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000141307
Gene: ENSMUSG00000025789
AA Change: I75N

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 25 38 N/A INTRINSIC
Pfam:Glyco_transf_29 84 206 5.8e-36 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.4%
  • 20x: 94.6%
Validation Efficiency 99% (67/68)
MGI Phenotype Strain: 3051219
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II membrane protein that is thought to catalyze the transfer of sialic acid from CMP-sialic acid to N-linked oligosaccharides and glycoproteins. The encoded protein may be found in the Golgi apparatus and may be involved in the production of polysialic acid, a modulator of the adhesive properties of neural cell adhesion molecule (NCAM1). This protein is a member of glycosyltransferase family 29. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display abnormal mossy fiber morphology, increased exploration in new environment and impaired fear responses. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted(1)
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik C A 16: 88,707,891 R6L unknown Het
Anxa11 A G 14: 25,874,270 Q235R possibly damaging Het
Ap2b1 T A 11: 83,308,239 M1K probably null Het
Atl2 G A 17: 79,850,223 T563I probably benign Het
Azin1 A T 15: 38,492,343 S307R possibly damaging Het
Ccdc153 A G 9: 44,245,780 T118A probably benign Het
Chac1 G A 2: 119,353,534 V206I probably damaging Het
Chrm3 A G 13: 9,877,662 V446A probably benign Het
Cped1 T C 6: 22,123,649 F467S probably damaging Het
Csmd3 G A 15: 48,673,560 P82L probably damaging Het
Ddx60 T A 8: 61,977,950 S840T probably benign Het
Ddx60 C T 8: 61,998,681 H1202Y probably benign Het
Dnah8 T A 17: 30,765,635 N3102K probably benign Het
Dst A T 1: 34,116,128 K85M probably damaging Het
Ehbp1l1 T C 19: 5,718,757 I839M probably benign Het
Fam184b T A 5: 45,537,653 M750L probably benign Het
Frem2 T C 3: 53,572,378 T1965A probably benign Het
Ftl1 A T 7: 45,459,210 D41E probably benign Het
Garem2 G A 5: 30,116,737 W698* probably null Het
Glt8d2 T C 10: 82,652,906 Y283C probably damaging Het
Hars T C 18: 36,773,590 E109G possibly damaging Het
Hspb9 T C 11: 100,714,210 S121P probably damaging Het
Hus1b A T 13: 30,947,205 L157Q probably damaging Het
Hykk A G 9: 54,946,359 M322V probably benign Het
Igkv4-61 C A 6: 69,417,154 A31S possibly damaging Het
Il17f T A 1: 20,777,907 M116L probably benign Het
Kif22 T C 7: 127,028,932 K9E possibly damaging Het
Krt90 T C 15: 101,559,244 E233G probably benign Het
Lipg T C 18: 74,957,236 M81V probably benign Het
Mocos C T 18: 24,701,456 S850L probably damaging Het
Mug2 T A 6: 122,082,754 S1364T probably damaging Het
Neb A T 2: 52,185,328 N208K probably benign Het
Oca2 G T 7: 56,328,767 R561L probably benign Het
Olfm5 A G 7: 104,154,053 L401P probably damaging Het
Olfr109 T A 17: 37,467,080 Y291* probably null Het
Olfr1238 C A 2: 89,406,522 A186S possibly damaging Het
Olfr331 T C 11: 58,502,340 D72G probably damaging Het
Olfr828 G A 9: 18,815,892 T134M probably benign Het
Olfr952 T A 9: 39,426,891 Y60F probably damaging Het
Oxgr1 T C 14: 120,022,448 N116D probably damaging Het
Pcdha11 G T 18: 37,012,169 probably null Het
Pi4ka T C 16: 17,358,322 I418V probably benign Het
Pih1d2 T C 9: 50,618,609 V62A probably benign Het
Pkib T A 10: 57,728,138 V46E probably damaging Het
Pum1 A G 4: 130,728,287 probably null Het
Rbak G T 5: 143,176,552 Q19K possibly damaging Het
Sema3c A G 5: 17,576,961 T32A probably damaging Het
Shprh T C 10: 11,167,873 W835R probably damaging Het
Sis T G 3: 72,911,854 K1456N probably damaging Het
Slc4a4 A T 5: 89,179,729 N675I probably benign Het
Slc8a3 C A 12: 81,315,627 M139I probably damaging Het
Sorcs3 T C 19: 48,802,759 F1182S probably damaging Het
Stx19 T C 16: 62,822,057 S79P probably damaging Het
Tecta C T 9: 42,375,267 V698M probably damaging Het
Timm22 T C 11: 76,411,139 S150P probably damaging Het
Tjp1 C T 7: 65,313,205 D995N possibly damaging Het
Tmem135 T A 7: 89,147,794 T365S probably benign Het
Tmem174 T C 13: 98,636,981 T114A probably benign Het
Tnc A G 4: 64,007,816 I909T probably benign Het
Trcg1 A G 9: 57,241,330 I62V possibly damaging Het
Tulp1 A T 17: 28,356,031 *487K probably null Het
Unc79 T A 12: 103,131,646 V1826E possibly damaging Het
Vmn2r13 A T 5: 109,174,116 N238K probably damaging Het
Vmn2r22 T A 6: 123,637,738 N298Y probably damaging Het
Vmn2r23 T A 6: 123,712,902 F246I probably damaging Het
Vps9d1 A C 8: 123,248,639 V194G probably damaging Het
Zfp260 A T 7: 30,104,810 H45L possibly damaging Het
Zfp846 A T 9: 20,593,720 H292L possibly damaging Het
Other mutations in St8sia2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02161:St8sia2 APN 7 73976682 missense probably benign 0.00
IGL02261:St8sia2 APN 7 73966846 missense probably damaging 1.00
IGL02941:St8sia2 APN 7 73976649 intron probably benign
IGL02971:St8sia2 APN 7 73966811 missense probably damaging 1.00
BB001:St8sia2 UTSW 7 73966952 missense probably damaging 1.00
BB011:St8sia2 UTSW 7 73966952 missense probably damaging 1.00
IGL03147:St8sia2 UTSW 7 73966819 missense probably damaging 1.00
R0052:St8sia2 UTSW 7 73943290 nonsense probably null
R0052:St8sia2 UTSW 7 73943290 nonsense probably null
R0052:St8sia2 UTSW 7 73971952 missense probably damaging 1.00
R0733:St8sia2 UTSW 7 73960840 missense probably benign
R1202:St8sia2 UTSW 7 73972035 missense probably benign 0.43
R1419:St8sia2 UTSW 7 73966994 nonsense probably null
R1962:St8sia2 UTSW 7 73943309 missense probably damaging 1.00
R2051:St8sia2 UTSW 7 73943202 missense possibly damaging 0.91
R4106:St8sia2 UTSW 7 73960761 missense probably damaging 1.00
R4989:St8sia2 UTSW 7 73966961 missense possibly damaging 0.75
R5541:St8sia2 UTSW 7 73966900 missense probably benign 0.00
R5859:St8sia2 UTSW 7 73966906 missense probably damaging 1.00
R6029:St8sia2 UTSW 7 73960710 missense possibly damaging 0.96
R6260:St8sia2 UTSW 7 73976693 missense possibly damaging 0.56
R7371:St8sia2 UTSW 7 73966927 missense probably damaging 0.99
R7424:St8sia2 UTSW 7 73960902 missense possibly damaging 0.66
R7763:St8sia2 UTSW 7 73943321 missense probably damaging 1.00
R7924:St8sia2 UTSW 7 73966952 missense probably damaging 1.00
R8688:St8sia2 UTSW 7 73943344 missense probably damaging 1.00
R9137:St8sia2 UTSW 7 73960906 missense probably benign 0.03
R9139:St8sia2 UTSW 7 73966765 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATATCCATTTGGGGCATGCG -3'
(R):5'- CTATTAGACGTACGTGTCGTGG -3'

Sequencing Primer
(F):5'- ATGCGGCTGGACTTGTCC -3'
(R):5'- GGCAGGCTCACAGATCATCTC -3'
Posted On 2018-05-24