Incidental Mutation 'R6416:Tmem135'
ID 517931
Institutional Source Beutler Lab
Gene Symbol Tmem135
Ensembl Gene ENSMUSG00000039428
Gene Name transmembrane protein 135
Synonyms 2810439K08Rik
MMRRC Submission 044558-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.116) question?
Stock # R6416 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 88788922-89053430 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 88797002 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 365 (T365S)
Ref Sequence ENSEMBL: ENSMUSP00000114097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041968] [ENSMUST00000117852]
AlphaFold Q9CYV5
Predicted Effect probably benign
Transcript: ENSMUST00000041968
SMART Domains Protein: ENSMUSP00000042783
Gene: ENSMUSG00000039428

DomainStartEndE-ValueType
Pfam:TMEM135_C_rich 9 142 2.2e-84 PFAM
transmembrane domain 147 169 N/A INTRINSIC
Pfam:Tim17 249 370 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117852
AA Change: T365S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114097
Gene: ENSMUSG00000039428
AA Change: T365S

DomainStartEndE-ValueType
low complexity region 52 65 N/A INTRINSIC
transmembrane domain 67 89 N/A INTRINSIC
transmembrane domain 96 115 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 299 321 N/A INTRINSIC
transmembrane domain 331 353 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207335
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.4%
  • 20x: 94.6%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik C A 16: 88,504,779 (GRCm39) R6L unknown Het
Anxa11 A G 14: 25,874,694 (GRCm39) Q235R possibly damaging Het
Ap2b1 T A 11: 83,199,065 (GRCm39) M1K probably null Het
Atl2 G A 17: 80,157,652 (GRCm39) T563I probably benign Het
Azin1 A T 15: 38,492,587 (GRCm39) S307R possibly damaging Het
Ccdc153 A G 9: 44,157,077 (GRCm39) T118A probably benign Het
Chac1 G A 2: 119,184,015 (GRCm39) V206I probably damaging Het
Chrm3 A G 13: 9,927,698 (GRCm39) V446A probably benign Het
Cped1 T C 6: 22,123,648 (GRCm39) F467S probably damaging Het
Csmd3 G A 15: 48,536,956 (GRCm39) P82L probably damaging Het
Ddx60 T A 8: 62,430,984 (GRCm39) S840T probably benign Het
Ddx60 C T 8: 62,451,715 (GRCm39) H1202Y probably benign Het
Dnah8 T A 17: 30,984,609 (GRCm39) N3102K probably benign Het
Dst A T 1: 34,155,209 (GRCm39) K85M probably damaging Het
Ehbp1l1 T C 19: 5,768,785 (GRCm39) I839M probably benign Het
Fam184b T A 5: 45,694,995 (GRCm39) M750L probably benign Het
Frem2 T C 3: 53,479,799 (GRCm39) T1965A probably benign Het
Ftl1 A T 7: 45,108,634 (GRCm39) D41E probably benign Het
Garem2 G A 5: 30,321,735 (GRCm39) W698* probably null Het
Glt8d2 T C 10: 82,488,740 (GRCm39) Y283C probably damaging Het
Hars1 T C 18: 36,906,643 (GRCm39) E109G possibly damaging Het
Hspb9 T C 11: 100,605,036 (GRCm39) S121P probably damaging Het
Hus1b A T 13: 31,131,188 (GRCm39) L157Q probably damaging Het
Hykk A G 9: 54,853,643 (GRCm39) M322V probably benign Het
Igkv4-61 C A 6: 69,394,138 (GRCm39) A31S possibly damaging Het
Il17f T A 1: 20,848,131 (GRCm39) M116L probably benign Het
Kif22 T C 7: 126,628,104 (GRCm39) K9E possibly damaging Het
Krt90 T C 15: 101,467,679 (GRCm39) E233G probably benign Het
Lipg T C 18: 75,090,307 (GRCm39) M81V probably benign Het
Mocos C T 18: 24,834,513 (GRCm39) S850L probably damaging Het
Mug2 T A 6: 122,059,713 (GRCm39) S1364T probably damaging Het
Neb A T 2: 52,075,340 (GRCm39) N208K probably benign Het
Oca2 G T 7: 55,978,515 (GRCm39) R561L probably benign Het
Olfm5 A G 7: 103,803,260 (GRCm39) L401P probably damaging Het
Or12d17 T A 17: 37,777,971 (GRCm39) Y291* probably null Het
Or2t49 T C 11: 58,393,166 (GRCm39) D72G probably damaging Het
Or4a39 C A 2: 89,236,866 (GRCm39) A186S possibly damaging Het
Or7g16 G A 9: 18,727,188 (GRCm39) T134M probably benign Het
Or8g33 T A 9: 39,338,187 (GRCm39) Y60F probably damaging Het
Oxgr1 T C 14: 120,259,860 (GRCm39) N116D probably damaging Het
Pcdha11 G T 18: 37,145,222 (GRCm39) probably null Het
Pi4ka T C 16: 17,176,186 (GRCm39) I418V probably benign Het
Pih1d2 T C 9: 50,529,909 (GRCm39) V62A probably benign Het
Pkib T A 10: 57,604,234 (GRCm39) V46E probably damaging Het
Pum1 A G 4: 130,455,598 (GRCm39) probably null Het
Rbak G T 5: 143,162,307 (GRCm39) Q19K possibly damaging Het
Sema3c A G 5: 17,781,959 (GRCm39) T32A probably damaging Het
Shprh T C 10: 11,043,617 (GRCm39) W835R probably damaging Het
Sis T G 3: 72,819,187 (GRCm39) K1456N probably damaging Het
Slc4a4 A T 5: 89,327,588 (GRCm39) N675I probably benign Het
Slc8a3 C A 12: 81,362,401 (GRCm39) M139I probably damaging Het
Sorcs3 T C 19: 48,791,198 (GRCm39) F1182S probably damaging Het
St8sia2 A T 7: 73,621,669 (GRCm39) I96N probably damaging Het
Stx19 T C 16: 62,642,420 (GRCm39) S79P probably damaging Het
Tecta C T 9: 42,286,563 (GRCm39) V698M probably damaging Het
Timm22 T C 11: 76,301,965 (GRCm39) S150P probably damaging Het
Tjp1 C T 7: 64,962,953 (GRCm39) D995N possibly damaging Het
Tmem174 T C 13: 98,773,489 (GRCm39) T114A probably benign Het
Tnc A G 4: 63,926,053 (GRCm39) I909T probably benign Het
Trcg1 A G 9: 57,148,613 (GRCm39) I62V possibly damaging Het
Tulp1 A T 17: 28,575,005 (GRCm39) *487K probably null Het
Unc79 T A 12: 103,097,905 (GRCm39) V1826E possibly damaging Het
Vmn2r13 A T 5: 109,321,982 (GRCm39) N238K probably damaging Het
Vmn2r22 T A 6: 123,614,697 (GRCm39) N298Y probably damaging Het
Vmn2r23 T A 6: 123,689,861 (GRCm39) F246I probably damaging Het
Vps9d1 A C 8: 123,975,378 (GRCm39) V194G probably damaging Het
Zfp260 A T 7: 29,804,235 (GRCm39) H45L possibly damaging Het
Zfp846 A T 9: 20,505,016 (GRCm39) H292L possibly damaging Het
Other mutations in Tmem135
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01459:Tmem135 APN 7 88,800,646 (GRCm39) missense probably damaging 1.00
IGL01730:Tmem135 APN 7 88,797,252 (GRCm39) missense possibly damaging 0.82
IGL01933:Tmem135 APN 7 88,793,065 (GRCm39) unclassified probably benign
IGL02177:Tmem135 APN 7 88,987,661 (GRCm39) missense probably damaging 1.00
IGL02305:Tmem135 APN 7 88,814,331 (GRCm39) critical splice donor site probably null
IGL02747:Tmem135 APN 7 88,793,878 (GRCm39) missense probably damaging 0.98
IGL02801:Tmem135 APN 7 88,803,333 (GRCm39) missense probably benign 0.13
IGL03353:Tmem135 APN 7 88,791,161 (GRCm39) missense probably damaging 1.00
Skim UTSW 7 88,845,335 (GRCm39) nonsense probably null
R0631:Tmem135 UTSW 7 88,792,996 (GRCm39) nonsense probably null
R0657:Tmem135 UTSW 7 88,793,890 (GRCm39) missense probably damaging 0.96
R2233:Tmem135 UTSW 7 88,803,282 (GRCm39) missense probably damaging 1.00
R3118:Tmem135 UTSW 7 88,797,005 (GRCm39) missense probably benign 0.02
R3119:Tmem135 UTSW 7 88,797,005 (GRCm39) missense probably benign 0.02
R5094:Tmem135 UTSW 7 88,793,001 (GRCm39) missense probably damaging 1.00
R5225:Tmem135 UTSW 7 88,845,335 (GRCm39) nonsense probably null
R5248:Tmem135 UTSW 7 88,797,200 (GRCm39) missense probably damaging 1.00
R5356:Tmem135 UTSW 7 88,954,723 (GRCm39) missense probably benign 0.06
R5372:Tmem135 UTSW 7 88,814,382 (GRCm39) splice site probably null
R5442:Tmem135 UTSW 7 88,793,872 (GRCm39) missense probably damaging 1.00
R5789:Tmem135 UTSW 7 88,845,330 (GRCm39) missense possibly damaging 0.73
R5863:Tmem135 UTSW 7 88,797,176 (GRCm39) critical splice donor site probably null
R6158:Tmem135 UTSW 7 88,805,652 (GRCm39) missense probably benign 0.12
R6383:Tmem135 UTSW 7 88,793,878 (GRCm39) missense probably damaging 0.98
R6659:Tmem135 UTSW 7 88,956,372 (GRCm39) nonsense probably null
R6659:Tmem135 UTSW 7 88,956,371 (GRCm39) missense probably benign 0.07
R6731:Tmem135 UTSW 7 88,893,172 (GRCm39) missense possibly damaging 0.96
R7545:Tmem135 UTSW 7 88,954,727 (GRCm39) missense probably damaging 1.00
R7626:Tmem135 UTSW 7 88,805,718 (GRCm39) splice site probably null
R8089:Tmem135 UTSW 7 88,805,703 (GRCm39) missense probably damaging 0.99
R8447:Tmem135 UTSW 7 88,803,240 (GRCm39) missense probably damaging 1.00
R8703:Tmem135 UTSW 7 88,808,170 (GRCm39) missense probably benign 0.00
R8750:Tmem135 UTSW 7 88,956,456 (GRCm39) missense probably damaging 0.99
R8758:Tmem135 UTSW 7 88,954,721 (GRCm39) missense probably benign 0.04
R8806:Tmem135 UTSW 7 88,797,186 (GRCm39) missense probably benign 0.25
R8807:Tmem135 UTSW 7 88,797,186 (GRCm39) missense probably benign 0.25
R8808:Tmem135 UTSW 7 88,797,186 (GRCm39) missense probably benign 0.25
R8835:Tmem135 UTSW 7 88,797,186 (GRCm39) missense probably benign 0.25
R8836:Tmem135 UTSW 7 88,797,186 (GRCm39) missense probably benign 0.25
R9093:Tmem135 UTSW 7 88,797,204 (GRCm39) missense probably benign 0.02
R9120:Tmem135 UTSW 7 88,797,186 (GRCm39) missense probably benign 0.25
R9122:Tmem135 UTSW 7 88,797,186 (GRCm39) missense probably benign 0.25
R9308:Tmem135 UTSW 7 88,797,186 (GRCm39) missense probably benign 0.25
R9649:Tmem135 UTSW 7 88,797,186 (GRCm39) missense probably benign 0.25
R9650:Tmem135 UTSW 7 88,797,186 (GRCm39) missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CAATGGCTCAAAAGGATGGC -3'
(R):5'- CACAGCTCTTATGCCTGAGAAG -3'

Sequencing Primer
(F):5'- GATGAAAACAAATCACTCATGGGC -3'
(R):5'- CTTATGCCTGAGAAGTTGCCAAGC -3'
Posted On 2018-05-24