Incidental Mutation 'R6416:Olfm5'
ID517932
Institutional Source Beutler Lab
Gene Symbol Olfm5
Ensembl Gene ENSMUSG00000044265
Gene Nameolfactomedin 5
SynonymsE030002O03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R6416 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location104153013-104164831 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104154053 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 401 (L401P)
Ref Sequence ENSEMBL: ENSMUSP00000052174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051137] [ENSMUST00000059121] [ENSMUST00000154555]
Predicted Effect probably damaging
Transcript: ENSMUST00000051137
AA Change: L401P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052174
Gene: ENSMUSG00000044265
AA Change: L401P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
coiled coil region 47 85 N/A INTRINSIC
coiled coil region 157 198 N/A INTRINSIC
OLF 211 468 3.13e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000059121
SMART Domains Protein: ENSMUSP00000056365
Gene: ENSMUSG00000051437

DomainStartEndE-ValueType
UBQ 31 101 5.13e-16 SMART
Blast:STI1 199 237 8e-11 BLAST
low complexity region 339 350 N/A INTRINSIC
low complexity region 402 419 N/A INTRINSIC
PDB:2DNA|A 561 610 3e-26 PDB
Blast:UBA 568 604 1e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000154555
SMART Domains Protein: ENSMUSP00000117893
Gene: ENSMUSG00000044265

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
coiled coil region 47 123 N/A INTRINSIC
OLF 136 304 3.65e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.4%
  • 20x: 94.6%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik C A 16: 88,707,891 R6L unknown Het
Anxa11 A G 14: 25,874,270 Q235R possibly damaging Het
Ap2b1 T A 11: 83,308,239 M1K probably null Het
Atl2 G A 17: 79,850,223 T563I probably benign Het
Azin1 A T 15: 38,492,343 S307R possibly damaging Het
Ccdc153 A G 9: 44,245,780 T118A probably benign Het
Chac1 G A 2: 119,353,534 V206I probably damaging Het
Chrm3 A G 13: 9,877,662 V446A probably benign Het
Cped1 T C 6: 22,123,649 F467S probably damaging Het
Csmd3 G A 15: 48,673,560 P82L probably damaging Het
Ddx60 T A 8: 61,977,950 S840T probably benign Het
Ddx60 C T 8: 61,998,681 H1202Y probably benign Het
Dnah8 T A 17: 30,765,635 N3102K probably benign Het
Dst A T 1: 34,116,128 K85M probably damaging Het
Ehbp1l1 T C 19: 5,718,757 I839M probably benign Het
Fam184b T A 5: 45,537,653 M750L probably benign Het
Frem2 T C 3: 53,572,378 T1965A probably benign Het
Ftl1 A T 7: 45,459,210 D41E probably benign Het
Garem2 G A 5: 30,116,737 W698* probably null Het
Glt8d2 T C 10: 82,652,906 Y283C probably damaging Het
Hars T C 18: 36,773,590 E109G possibly damaging Het
Hspb9 T C 11: 100,714,210 S121P probably damaging Het
Hus1b A T 13: 30,947,205 L157Q probably damaging Het
Hykk A G 9: 54,946,359 M322V probably benign Het
Igkv4-61 C A 6: 69,417,154 A31S possibly damaging Het
Il17f T A 1: 20,777,907 M116L probably benign Het
Kif22 T C 7: 127,028,932 K9E possibly damaging Het
Krt90 T C 15: 101,559,244 E233G probably benign Het
Lipg T C 18: 74,957,236 M81V probably benign Het
Mocos C T 18: 24,701,456 S850L probably damaging Het
Mug2 T A 6: 122,082,754 S1364T probably damaging Het
Neb A T 2: 52,185,328 N208K probably benign Het
Oca2 G T 7: 56,328,767 R561L probably benign Het
Olfr109 T A 17: 37,467,080 Y291* probably null Het
Olfr1238 C A 2: 89,406,522 A186S possibly damaging Het
Olfr331 T C 11: 58,502,340 D72G probably damaging Het
Olfr828 G A 9: 18,815,892 T134M probably benign Het
Olfr952 T A 9: 39,426,891 Y60F probably damaging Het
Oxgr1 T C 14: 120,022,448 N116D probably damaging Het
Pcdha11 G T 18: 37,012,169 probably null Het
Pi4ka T C 16: 17,358,322 I418V probably benign Het
Pih1d2 T C 9: 50,618,609 V62A probably benign Het
Pkib T A 10: 57,728,138 V46E probably damaging Het
Pum1 A G 4: 130,728,287 probably null Het
Rbak G T 5: 143,176,552 Q19K possibly damaging Het
Sema3c A G 5: 17,576,961 T32A probably damaging Het
Shprh T C 10: 11,167,873 W835R probably damaging Het
Sis T G 3: 72,911,854 K1456N probably damaging Het
Slc4a4 A T 5: 89,179,729 N675I probably benign Het
Slc8a3 C A 12: 81,315,627 M139I probably damaging Het
Sorcs3 T C 19: 48,802,759 F1182S probably damaging Het
St8sia2 A T 7: 73,971,921 I96N probably damaging Het
Stx19 T C 16: 62,822,057 S79P probably damaging Het
Tecta C T 9: 42,375,267 V698M probably damaging Het
Timm22 T C 11: 76,411,139 S150P probably damaging Het
Tjp1 C T 7: 65,313,205 D995N possibly damaging Het
Tmem135 T A 7: 89,147,794 T365S probably benign Het
Tmem174 T C 13: 98,636,981 T114A probably benign Het
Tnc A G 4: 64,007,816 I909T probably benign Het
Trcg1 A G 9: 57,241,330 I62V possibly damaging Het
Tulp1 A T 17: 28,356,031 *487K probably null Het
Unc79 T A 12: 103,131,646 V1826E possibly damaging Het
Vmn2r13 A T 5: 109,174,116 N238K probably damaging Het
Vmn2r22 T A 6: 123,637,738 N298Y probably damaging Het
Vmn2r23 T A 6: 123,712,902 F246I probably damaging Het
Vps9d1 A C 8: 123,248,639 V194G probably damaging Het
Zfp260 A T 7: 30,104,810 H45L possibly damaging Het
Zfp846 A T 9: 20,593,720 H292L possibly damaging Het
Other mutations in Olfm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01843:Olfm5 APN 7 104160744 missense possibly damaging 0.77
IGL02097:Olfm5 APN 7 104154231 missense probably benign 0.20
IGL02322:Olfm5 APN 7 104154401 missense probably damaging 1.00
IGL02324:Olfm5 APN 7 104154095 splice site probably null
IGL02702:Olfm5 APN 7 104154357 missense probably damaging 1.00
R0128:Olfm5 UTSW 7 104160926 missense probably benign
R0400:Olfm5 UTSW 7 104154179 missense probably damaging 1.00
R0600:Olfm5 UTSW 7 104153869 nonsense probably null
R0610:Olfm5 UTSW 7 104154445 nonsense probably null
R0699:Olfm5 UTSW 7 104154119 missense probably damaging 1.00
R1960:Olfm5 UTSW 7 104160412 missense possibly damaging 0.85
R1978:Olfm5 UTSW 7 104164741 missense unknown
R2391:Olfm5 UTSW 7 104160834 missense probably benign 0.00
R3774:Olfm5 UTSW 7 104161849 missense possibly damaging 0.67
R4632:Olfm5 UTSW 7 104160893 missense probably benign 0.00
R4770:Olfm5 UTSW 7 104160478 missense probably benign 0.04
R4838:Olfm5 UTSW 7 104154365 missense probably damaging 1.00
R5274:Olfm5 UTSW 7 104159983 missense probably damaging 1.00
R5455:Olfm5 UTSW 7 104154462 missense probably damaging 0.99
R5930:Olfm5 UTSW 7 104154155 missense probably damaging 1.00
R7126:Olfm5 UTSW 7 104159980 missense probably damaging 1.00
R7535:Olfm5 UTSW 7 104154237 missense possibly damaging 0.92
R7682:Olfm5 UTSW 7 104161772 missense probably null 0.49
R7835:Olfm5 UTSW 7 104154445 nonsense probably null
R8308:Olfm5 UTSW 7 104154399 missense probably damaging 1.00
R8531:Olfm5 UTSW 7 104153822 missense probably benign 0.00
X0011:Olfm5 UTSW 7 104153946 missense possibly damaging 0.91
Z1088:Olfm5 UTSW 7 104154150 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTCGGTACCTTTTGCTTTAG -3'
(R):5'- TTTTGCGCCTTGGACTGAC -3'

Sequencing Primer
(F):5'- ACCTTTTGCTTTAGTGTCAGGAAG -3'
(R):5'- GCGCCTTGGACTGACATAGATTTTAC -3'
Posted On2018-05-24