Incidental Mutation 'R6416:Kif22'
ID 517933
Institutional Source Beutler Lab
Gene Symbol Kif22
Ensembl Gene ENSMUSG00000030677
Gene Name kinesin family member 22
Synonyms Kid, Kif22a
MMRRC Submission 044558-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6416 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 126626901-126641639 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 126628104 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 9 (K9E)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032915] [ENSMUST00000032916] [ENSMUST00000205461] [ENSMUST00000205568] [ENSMUST00000205806] [ENSMUST00000206254] [ENSMUST00000206291]
AlphaFold Q3V300
Predicted Effect probably benign
Transcript: ENSMUST00000032915
AA Change: K549E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032915
Gene: ENSMUSG00000030677
AA Change: K549E

DomainStartEndE-ValueType
KISc 36 371 1.12e-140 SMART
low complexity region 399 428 N/A INTRINSIC
coiled coil region 460 496 N/A INTRINSIC
HhH1 597 616 2.16e0 SMART
HhH1 627 646 8.65e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000032916
SMART Domains Protein: ENSMUSP00000032916
Gene: ENSMUSG00000030678

DomainStartEndE-ValueType
low complexity region 59 82 N/A INTRINSIC
low complexity region 90 126 N/A INTRINSIC
low complexity region 130 179 N/A INTRINSIC
ZnF_C2H2 190 212 4.11e-2 SMART
low complexity region 231 272 N/A INTRINSIC
ZnF_C2H2 279 301 6.78e-3 SMART
ZnF_C2H2 307 329 4.87e-4 SMART
ZnF_C2H2 337 360 1.22e-4 SMART
ZnF_C2H2 366 388 1.79e-2 SMART
ZnF_C2H2 392 413 6.57e0 SMART
low complexity region 435 451 N/A INTRINSIC
low complexity region 465 476 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205461
Predicted Effect probably benign
Transcript: ENSMUST00000205568
Predicted Effect possibly damaging
Transcript: ENSMUST00000205754
AA Change: K9E

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000205806
Predicted Effect probably benign
Transcript: ENSMUST00000206254
Predicted Effect probably benign
Transcript: ENSMUST00000206291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206953
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206412
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206655
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206873
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.4%
  • 20x: 94.6%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the kinesin-like protein family. The family members are microtubule-dependent molecular motors that transport organelles within cells and move chromosomes during cell division. The C-terminal half of this protein has been shown to bind DNA. Studies with the Xenopus homolog suggests its essential role in metaphase chromosome alignment and maintenance. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality prior to implantation due to defective meiosis II and early embryo mitosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik C A 16: 88,504,779 (GRCm39) R6L unknown Het
Anxa11 A G 14: 25,874,694 (GRCm39) Q235R possibly damaging Het
Ap2b1 T A 11: 83,199,065 (GRCm39) M1K probably null Het
Atl2 G A 17: 80,157,652 (GRCm39) T563I probably benign Het
Azin1 A T 15: 38,492,587 (GRCm39) S307R possibly damaging Het
Ccdc153 A G 9: 44,157,077 (GRCm39) T118A probably benign Het
Chac1 G A 2: 119,184,015 (GRCm39) V206I probably damaging Het
Chrm3 A G 13: 9,927,698 (GRCm39) V446A probably benign Het
Cped1 T C 6: 22,123,648 (GRCm39) F467S probably damaging Het
Csmd3 G A 15: 48,536,956 (GRCm39) P82L probably damaging Het
Ddx60 T A 8: 62,430,984 (GRCm39) S840T probably benign Het
Ddx60 C T 8: 62,451,715 (GRCm39) H1202Y probably benign Het
Dnah8 T A 17: 30,984,609 (GRCm39) N3102K probably benign Het
Dst A T 1: 34,155,209 (GRCm39) K85M probably damaging Het
Ehbp1l1 T C 19: 5,768,785 (GRCm39) I839M probably benign Het
Fam184b T A 5: 45,694,995 (GRCm39) M750L probably benign Het
Frem2 T C 3: 53,479,799 (GRCm39) T1965A probably benign Het
Ftl1 A T 7: 45,108,634 (GRCm39) D41E probably benign Het
Garem2 G A 5: 30,321,735 (GRCm39) W698* probably null Het
Glt8d2 T C 10: 82,488,740 (GRCm39) Y283C probably damaging Het
Hars1 T C 18: 36,906,643 (GRCm39) E109G possibly damaging Het
Hspb9 T C 11: 100,605,036 (GRCm39) S121P probably damaging Het
Hus1b A T 13: 31,131,188 (GRCm39) L157Q probably damaging Het
Hykk A G 9: 54,853,643 (GRCm39) M322V probably benign Het
Igkv4-61 C A 6: 69,394,138 (GRCm39) A31S possibly damaging Het
Il17f T A 1: 20,848,131 (GRCm39) M116L probably benign Het
Krt90 T C 15: 101,467,679 (GRCm39) E233G probably benign Het
Lipg T C 18: 75,090,307 (GRCm39) M81V probably benign Het
Mocos C T 18: 24,834,513 (GRCm39) S850L probably damaging Het
Mug2 T A 6: 122,059,713 (GRCm39) S1364T probably damaging Het
Neb A T 2: 52,075,340 (GRCm39) N208K probably benign Het
Oca2 G T 7: 55,978,515 (GRCm39) R561L probably benign Het
Olfm5 A G 7: 103,803,260 (GRCm39) L401P probably damaging Het
Or12d17 T A 17: 37,777,971 (GRCm39) Y291* probably null Het
Or2t49 T C 11: 58,393,166 (GRCm39) D72G probably damaging Het
Or4a39 C A 2: 89,236,866 (GRCm39) A186S possibly damaging Het
Or7g16 G A 9: 18,727,188 (GRCm39) T134M probably benign Het
Or8g33 T A 9: 39,338,187 (GRCm39) Y60F probably damaging Het
Oxgr1 T C 14: 120,259,860 (GRCm39) N116D probably damaging Het
Pcdha11 G T 18: 37,145,222 (GRCm39) probably null Het
Pi4ka T C 16: 17,176,186 (GRCm39) I418V probably benign Het
Pih1d2 T C 9: 50,529,909 (GRCm39) V62A probably benign Het
Pkib T A 10: 57,604,234 (GRCm39) V46E probably damaging Het
Pum1 A G 4: 130,455,598 (GRCm39) probably null Het
Rbak G T 5: 143,162,307 (GRCm39) Q19K possibly damaging Het
Sema3c A G 5: 17,781,959 (GRCm39) T32A probably damaging Het
Shprh T C 10: 11,043,617 (GRCm39) W835R probably damaging Het
Sis T G 3: 72,819,187 (GRCm39) K1456N probably damaging Het
Slc4a4 A T 5: 89,327,588 (GRCm39) N675I probably benign Het
Slc8a3 C A 12: 81,362,401 (GRCm39) M139I probably damaging Het
Sorcs3 T C 19: 48,791,198 (GRCm39) F1182S probably damaging Het
St8sia2 A T 7: 73,621,669 (GRCm39) I96N probably damaging Het
Stx19 T C 16: 62,642,420 (GRCm39) S79P probably damaging Het
Tecta C T 9: 42,286,563 (GRCm39) V698M probably damaging Het
Timm22 T C 11: 76,301,965 (GRCm39) S150P probably damaging Het
Tjp1 C T 7: 64,962,953 (GRCm39) D995N possibly damaging Het
Tmem135 T A 7: 88,797,002 (GRCm39) T365S probably benign Het
Tmem174 T C 13: 98,773,489 (GRCm39) T114A probably benign Het
Tnc A G 4: 63,926,053 (GRCm39) I909T probably benign Het
Trcg1 A G 9: 57,148,613 (GRCm39) I62V possibly damaging Het
Tulp1 A T 17: 28,575,005 (GRCm39) *487K probably null Het
Unc79 T A 12: 103,097,905 (GRCm39) V1826E possibly damaging Het
Vmn2r13 A T 5: 109,321,982 (GRCm39) N238K probably damaging Het
Vmn2r22 T A 6: 123,614,697 (GRCm39) N298Y probably damaging Het
Vmn2r23 T A 6: 123,689,861 (GRCm39) F246I probably damaging Het
Vps9d1 A C 8: 123,975,378 (GRCm39) V194G probably damaging Het
Zfp260 A T 7: 29,804,235 (GRCm39) H45L possibly damaging Het
Zfp846 A T 9: 20,505,016 (GRCm39) H292L possibly damaging Het
Other mutations in Kif22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01289:Kif22 APN 7 126,632,645 (GRCm39) missense probably damaging 0.96
IGL01333:Kif22 APN 7 126,633,367 (GRCm39) missense probably damaging 1.00
R0207:Kif22 UTSW 7 126,641,572 (GRCm39) start codon destroyed probably null 0.73
R0723:Kif22 UTSW 7 126,633,078 (GRCm39) missense probably damaging 1.00
R1118:Kif22 UTSW 7 126,631,916 (GRCm39) missense probably benign
R1521:Kif22 UTSW 7 126,627,011 (GRCm39) missense probably damaging 0.99
R2036:Kif22 UTSW 7 126,630,126 (GRCm39) missense possibly damaging 0.94
R2092:Kif22 UTSW 7 126,632,802 (GRCm39) missense probably damaging 0.99
R3790:Kif22 UTSW 7 126,628,668 (GRCm39) missense probably damaging 1.00
R4587:Kif22 UTSW 7 126,632,052 (GRCm39) critical splice donor site probably null
R4667:Kif22 UTSW 7 126,632,500 (GRCm39) missense probably damaging 1.00
R5082:Kif22 UTSW 7 126,632,549 (GRCm39) missense possibly damaging 0.71
R5853:Kif22 UTSW 7 126,632,539 (GRCm39) missense possibly damaging 0.92
R6045:Kif22 UTSW 7 126,630,250 (GRCm39) missense probably benign 0.00
R6175:Kif22 UTSW 7 126,630,228 (GRCm39) missense possibly damaging 0.53
R6195:Kif22 UTSW 7 126,628,131 (GRCm39) missense probably damaging 0.99
R6407:Kif22 UTSW 7 126,632,375 (GRCm39) missense probably damaging 1.00
R6561:Kif22 UTSW 7 126,630,225 (GRCm39) missense probably benign 0.38
R7122:Kif22 UTSW 7 126,632,150 (GRCm39) missense probably benign 0.01
R7644:Kif22 UTSW 7 126,632,134 (GRCm39) missense probably damaging 1.00
R8143:Kif22 UTSW 7 126,632,397 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATCCAGTCAGCAGCCAATC -3'
(R):5'- TCCAGGTTCCAGGAAGAAGC -3'

Sequencing Primer
(F):5'- TCCAAACACAAGGGGCATCAG -3'
(R):5'- GGTTAGCCTTATAGAATGAGACCCTG -3'
Posted On 2018-05-24