Incidental Mutation 'R6416:Kif22'
ID517933
Institutional Source Beutler Lab
Gene Symbol Kif22
Ensembl Gene ENSMUSG00000030677
Gene Namekinesin family member 22
SynonymsKid, Kif22a
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6416 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location127027729-127042471 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127028932 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 9 (K9E)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032915] [ENSMUST00000032916] [ENSMUST00000205461] [ENSMUST00000205568] [ENSMUST00000205806] [ENSMUST00000206254] [ENSMUST00000206291]
Predicted Effect probably benign
Transcript: ENSMUST00000032915
AA Change: K549E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032915
Gene: ENSMUSG00000030677
AA Change: K549E

DomainStartEndE-ValueType
KISc 36 371 1.12e-140 SMART
low complexity region 399 428 N/A INTRINSIC
coiled coil region 460 496 N/A INTRINSIC
HhH1 597 616 2.16e0 SMART
HhH1 627 646 8.65e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000032916
SMART Domains Protein: ENSMUSP00000032916
Gene: ENSMUSG00000030678

DomainStartEndE-ValueType
low complexity region 59 82 N/A INTRINSIC
low complexity region 90 126 N/A INTRINSIC
low complexity region 130 179 N/A INTRINSIC
ZnF_C2H2 190 212 4.11e-2 SMART
low complexity region 231 272 N/A INTRINSIC
ZnF_C2H2 279 301 6.78e-3 SMART
ZnF_C2H2 307 329 4.87e-4 SMART
ZnF_C2H2 337 360 1.22e-4 SMART
ZnF_C2H2 366 388 1.79e-2 SMART
ZnF_C2H2 392 413 6.57e0 SMART
low complexity region 435 451 N/A INTRINSIC
low complexity region 465 476 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205461
Predicted Effect probably benign
Transcript: ENSMUST00000205568
Predicted Effect possibly damaging
Transcript: ENSMUST00000205754
AA Change: K9E

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000205806
Predicted Effect probably benign
Transcript: ENSMUST00000206254
Predicted Effect probably benign
Transcript: ENSMUST00000206291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206412
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206655
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206873
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206953
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206924
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.4%
  • 20x: 94.6%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the kinesin-like protein family. The family members are microtubule-dependent molecular motors that transport organelles within cells and move chromosomes during cell division. The C-terminal half of this protein has been shown to bind DNA. Studies with the Xenopus homolog suggests its essential role in metaphase chromosome alignment and maintenance. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality prior to implantation due to defective meiosis II and early embryo mitosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik C A 16: 88,707,891 R6L unknown Het
Anxa11 A G 14: 25,874,270 Q235R possibly damaging Het
Ap2b1 T A 11: 83,308,239 M1K probably null Het
Atl2 G A 17: 79,850,223 T563I probably benign Het
Azin1 A T 15: 38,492,343 S307R possibly damaging Het
Ccdc153 A G 9: 44,245,780 T118A probably benign Het
Chac1 G A 2: 119,353,534 V206I probably damaging Het
Chrm3 A G 13: 9,877,662 V446A probably benign Het
Cped1 T C 6: 22,123,649 F467S probably damaging Het
Csmd3 G A 15: 48,673,560 P82L probably damaging Het
Ddx60 T A 8: 61,977,950 S840T probably benign Het
Ddx60 C T 8: 61,998,681 H1202Y probably benign Het
Dnah8 T A 17: 30,765,635 N3102K probably benign Het
Dst A T 1: 34,116,128 K85M probably damaging Het
Ehbp1l1 T C 19: 5,718,757 I839M probably benign Het
Fam184b T A 5: 45,537,653 M750L probably benign Het
Frem2 T C 3: 53,572,378 T1965A probably benign Het
Ftl1 A T 7: 45,459,210 D41E probably benign Het
Garem2 G A 5: 30,116,737 W698* probably null Het
Glt8d2 T C 10: 82,652,906 Y283C probably damaging Het
Hars T C 18: 36,773,590 E109G possibly damaging Het
Hspb9 T C 11: 100,714,210 S121P probably damaging Het
Hus1b A T 13: 30,947,205 L157Q probably damaging Het
Hykk A G 9: 54,946,359 M322V probably benign Het
Igkv4-61 C A 6: 69,417,154 A31S possibly damaging Het
Il17f T A 1: 20,777,907 M116L probably benign Het
Krt90 T C 15: 101,559,244 E233G probably benign Het
Lipg T C 18: 74,957,236 M81V probably benign Het
Mocos C T 18: 24,701,456 S850L probably damaging Het
Mug2 T A 6: 122,082,754 S1364T probably damaging Het
Neb A T 2: 52,185,328 N208K probably benign Het
Oca2 G T 7: 56,328,767 R561L probably benign Het
Olfm5 A G 7: 104,154,053 L401P probably damaging Het
Olfr109 T A 17: 37,467,080 Y291* probably null Het
Olfr1238 C A 2: 89,406,522 A186S possibly damaging Het
Olfr331 T C 11: 58,502,340 D72G probably damaging Het
Olfr828 G A 9: 18,815,892 T134M probably benign Het
Olfr952 T A 9: 39,426,891 Y60F probably damaging Het
Oxgr1 T C 14: 120,022,448 N116D probably damaging Het
Pcdha11 G T 18: 37,012,169 probably null Het
Pi4ka T C 16: 17,358,322 I418V probably benign Het
Pih1d2 T C 9: 50,618,609 V62A probably benign Het
Pkib T A 10: 57,728,138 V46E probably damaging Het
Pum1 A G 4: 130,728,287 probably null Het
Rbak G T 5: 143,176,552 Q19K possibly damaging Het
Sema3c A G 5: 17,576,961 T32A probably damaging Het
Shprh T C 10: 11,167,873 W835R probably damaging Het
Sis T G 3: 72,911,854 K1456N probably damaging Het
Slc4a4 A T 5: 89,179,729 N675I probably benign Het
Slc8a3 C A 12: 81,315,627 M139I probably damaging Het
Sorcs3 T C 19: 48,802,759 F1182S probably damaging Het
St8sia2 A T 7: 73,971,921 I96N probably damaging Het
Stx19 T C 16: 62,822,057 S79P probably damaging Het
Tecta C T 9: 42,375,267 V698M probably damaging Het
Timm22 T C 11: 76,411,139 S150P probably damaging Het
Tjp1 C T 7: 65,313,205 D995N possibly damaging Het
Tmem135 T A 7: 89,147,794 T365S probably benign Het
Tmem174 T C 13: 98,636,981 T114A probably benign Het
Tnc A G 4: 64,007,816 I909T probably benign Het
Trcg1 A G 9: 57,241,330 I62V possibly damaging Het
Tulp1 A T 17: 28,356,031 *487K probably null Het
Unc79 T A 12: 103,131,646 V1826E possibly damaging Het
Vmn2r13 A T 5: 109,174,116 N238K probably damaging Het
Vmn2r22 T A 6: 123,637,738 N298Y probably damaging Het
Vmn2r23 T A 6: 123,712,902 F246I probably damaging Het
Vps9d1 A C 8: 123,248,639 V194G probably damaging Het
Zfp260 A T 7: 30,104,810 H45L possibly damaging Het
Zfp846 A T 9: 20,593,720 H292L possibly damaging Het
Other mutations in Kif22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01289:Kif22 APN 7 127033473 missense probably damaging 0.96
IGL01333:Kif22 APN 7 127034195 missense probably damaging 1.00
R0207:Kif22 UTSW 7 127042400 start codon destroyed probably null 0.73
R0723:Kif22 UTSW 7 127033906 missense probably damaging 1.00
R1118:Kif22 UTSW 7 127032744 missense probably benign
R1521:Kif22 UTSW 7 127027839 missense probably damaging 0.99
R2036:Kif22 UTSW 7 127030954 missense possibly damaging 0.94
R2092:Kif22 UTSW 7 127033630 missense probably damaging 0.99
R3790:Kif22 UTSW 7 127029496 missense probably damaging 1.00
R4587:Kif22 UTSW 7 127032880 critical splice donor site probably null
R4667:Kif22 UTSW 7 127033328 missense probably damaging 1.00
R5082:Kif22 UTSW 7 127033377 missense possibly damaging 0.71
R5853:Kif22 UTSW 7 127033367 missense possibly damaging 0.92
R6045:Kif22 UTSW 7 127031078 missense probably benign 0.00
R6175:Kif22 UTSW 7 127031056 missense possibly damaging 0.53
R6195:Kif22 UTSW 7 127028959 missense probably damaging 0.99
R6407:Kif22 UTSW 7 127033203 missense probably damaging 1.00
R6561:Kif22 UTSW 7 127031053 missense probably benign 0.38
R7122:Kif22 UTSW 7 127032978 missense probably benign 0.01
R7644:Kif22 UTSW 7 127032962 missense probably damaging 1.00
R8143:Kif22 UTSW 7 127033225 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATCCAGTCAGCAGCCAATC -3'
(R):5'- TCCAGGTTCCAGGAAGAAGC -3'

Sequencing Primer
(F):5'- TCCAAACACAAGGGGCATCAG -3'
(R):5'- GGTTAGCCTTATAGAATGAGACCCTG -3'
Posted On2018-05-24