Incidental Mutation 'R6416:Ddx60'
ID 517934
Institutional Source Beutler Lab
Gene Symbol Ddx60
Ensembl Gene ENSMUSG00000037921
Gene Name DExD/H box helicase 60
Synonyms DEAD (Asp-Glu-Ala-Asp) box polypeptide 60
MMRRC Submission 044558-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.215) question?
Stock # R6416 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 62381121-62490735 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 62430984 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 840 (S840T)
Ref Sequence ENSEMBL: ENSMUSP00000091197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070631] [ENSMUST00000093485]
AlphaFold E9PZQ1
Predicted Effect probably benign
Transcript: ENSMUST00000070631
AA Change: S839T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000070741
Gene: ENSMUSG00000037921
AA Change: S839T

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 758 949 1.05e-15 SMART
Blast:DEXDc 1007 1132 4e-24 BLAST
HELICc 1245 1328 4.35e-13 SMART
low complexity region 1362 1373 N/A INTRINSIC
Blast:DEXDc 1503 1584 1e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000093485
AA Change: S840T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000091197
Gene: ENSMUSG00000037921
AA Change: S840T

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 759 950 1.05e-15 SMART
Blast:DEXDc 1008 1133 4e-24 BLAST
HELICc 1246 1329 4.35e-13 SMART
low complexity region 1363 1374 N/A INTRINSIC
Blast:DEXDc 1504 1585 1e-20 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.4%
  • 20x: 94.6%
Validation Efficiency 99% (67/68)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal immunity to several viruses (IAV, EMCV, SINV) but increased susceptibility to VSV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik C A 16: 88,504,779 (GRCm39) R6L unknown Het
Anxa11 A G 14: 25,874,694 (GRCm39) Q235R possibly damaging Het
Ap2b1 T A 11: 83,199,065 (GRCm39) M1K probably null Het
Atl2 G A 17: 80,157,652 (GRCm39) T563I probably benign Het
Azin1 A T 15: 38,492,587 (GRCm39) S307R possibly damaging Het
Ccdc153 A G 9: 44,157,077 (GRCm39) T118A probably benign Het
Chac1 G A 2: 119,184,015 (GRCm39) V206I probably damaging Het
Chrm3 A G 13: 9,927,698 (GRCm39) V446A probably benign Het
Cped1 T C 6: 22,123,648 (GRCm39) F467S probably damaging Het
Csmd3 G A 15: 48,536,956 (GRCm39) P82L probably damaging Het
Dnah8 T A 17: 30,984,609 (GRCm39) N3102K probably benign Het
Dst A T 1: 34,155,209 (GRCm39) K85M probably damaging Het
Ehbp1l1 T C 19: 5,768,785 (GRCm39) I839M probably benign Het
Fam184b T A 5: 45,694,995 (GRCm39) M750L probably benign Het
Frem2 T C 3: 53,479,799 (GRCm39) T1965A probably benign Het
Ftl1 A T 7: 45,108,634 (GRCm39) D41E probably benign Het
Garem2 G A 5: 30,321,735 (GRCm39) W698* probably null Het
Glt8d2 T C 10: 82,488,740 (GRCm39) Y283C probably damaging Het
Hars1 T C 18: 36,906,643 (GRCm39) E109G possibly damaging Het
Hspb9 T C 11: 100,605,036 (GRCm39) S121P probably damaging Het
Hus1b A T 13: 31,131,188 (GRCm39) L157Q probably damaging Het
Hykk A G 9: 54,853,643 (GRCm39) M322V probably benign Het
Igkv4-61 C A 6: 69,394,138 (GRCm39) A31S possibly damaging Het
Il17f T A 1: 20,848,131 (GRCm39) M116L probably benign Het
Kif22 T C 7: 126,628,104 (GRCm39) K9E possibly damaging Het
Krt90 T C 15: 101,467,679 (GRCm39) E233G probably benign Het
Lipg T C 18: 75,090,307 (GRCm39) M81V probably benign Het
Mocos C T 18: 24,834,513 (GRCm39) S850L probably damaging Het
Mug2 T A 6: 122,059,713 (GRCm39) S1364T probably damaging Het
Neb A T 2: 52,075,340 (GRCm39) N208K probably benign Het
Oca2 G T 7: 55,978,515 (GRCm39) R561L probably benign Het
Olfm5 A G 7: 103,803,260 (GRCm39) L401P probably damaging Het
Or12d17 T A 17: 37,777,971 (GRCm39) Y291* probably null Het
Or2t49 T C 11: 58,393,166 (GRCm39) D72G probably damaging Het
Or4a39 C A 2: 89,236,866 (GRCm39) A186S possibly damaging Het
Or7g16 G A 9: 18,727,188 (GRCm39) T134M probably benign Het
Or8g33 T A 9: 39,338,187 (GRCm39) Y60F probably damaging Het
Oxgr1 T C 14: 120,259,860 (GRCm39) N116D probably damaging Het
Pcdha11 G T 18: 37,145,222 (GRCm39) probably null Het
Pi4ka T C 16: 17,176,186 (GRCm39) I418V probably benign Het
Pih1d2 T C 9: 50,529,909 (GRCm39) V62A probably benign Het
Pkib T A 10: 57,604,234 (GRCm39) V46E probably damaging Het
Pum1 A G 4: 130,455,598 (GRCm39) probably null Het
Rbak G T 5: 143,162,307 (GRCm39) Q19K possibly damaging Het
Sema3c A G 5: 17,781,959 (GRCm39) T32A probably damaging Het
Shprh T C 10: 11,043,617 (GRCm39) W835R probably damaging Het
Sis T G 3: 72,819,187 (GRCm39) K1456N probably damaging Het
Slc4a4 A T 5: 89,327,588 (GRCm39) N675I probably benign Het
Slc8a3 C A 12: 81,362,401 (GRCm39) M139I probably damaging Het
Sorcs3 T C 19: 48,791,198 (GRCm39) F1182S probably damaging Het
St8sia2 A T 7: 73,621,669 (GRCm39) I96N probably damaging Het
Stx19 T C 16: 62,642,420 (GRCm39) S79P probably damaging Het
Tecta C T 9: 42,286,563 (GRCm39) V698M probably damaging Het
Timm22 T C 11: 76,301,965 (GRCm39) S150P probably damaging Het
Tjp1 C T 7: 64,962,953 (GRCm39) D995N possibly damaging Het
Tmem135 T A 7: 88,797,002 (GRCm39) T365S probably benign Het
Tmem174 T C 13: 98,773,489 (GRCm39) T114A probably benign Het
Tnc A G 4: 63,926,053 (GRCm39) I909T probably benign Het
Trcg1 A G 9: 57,148,613 (GRCm39) I62V possibly damaging Het
Tulp1 A T 17: 28,575,005 (GRCm39) *487K probably null Het
Unc79 T A 12: 103,097,905 (GRCm39) V1826E possibly damaging Het
Vmn2r13 A T 5: 109,321,982 (GRCm39) N238K probably damaging Het
Vmn2r22 T A 6: 123,614,697 (GRCm39) N298Y probably damaging Het
Vmn2r23 T A 6: 123,689,861 (GRCm39) F246I probably damaging Het
Vps9d1 A C 8: 123,975,378 (GRCm39) V194G probably damaging Het
Zfp260 A T 7: 29,804,235 (GRCm39) H45L possibly damaging Het
Zfp846 A T 9: 20,505,016 (GRCm39) H292L possibly damaging Het
Other mutations in Ddx60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ddx60 APN 8 62,411,680 (GRCm39) missense probably damaging 1.00
IGL00915:Ddx60 APN 8 62,440,465 (GRCm39) missense possibly damaging 0.79
IGL00931:Ddx60 APN 8 62,422,617 (GRCm39) missense probably benign 0.18
IGL01023:Ddx60 APN 8 62,395,548 (GRCm39) missense probably damaging 0.99
IGL01313:Ddx60 APN 8 62,435,560 (GRCm39) missense probably damaging 1.00
IGL01615:Ddx60 APN 8 62,416,774 (GRCm39) missense probably null 0.81
IGL01733:Ddx60 APN 8 62,436,899 (GRCm39) missense probably damaging 0.99
IGL01779:Ddx60 APN 8 62,470,857 (GRCm39) missense possibly damaging 0.94
IGL01900:Ddx60 APN 8 62,453,743 (GRCm39) splice site probably benign
IGL02110:Ddx60 APN 8 62,470,281 (GRCm39) critical splice donor site probably null
IGL02302:Ddx60 APN 8 62,428,866 (GRCm39) missense possibly damaging 0.85
IGL02468:Ddx60 APN 8 62,411,676 (GRCm39) missense probably damaging 1.00
IGL02569:Ddx60 APN 8 62,477,985 (GRCm39) missense possibly damaging 0.93
IGL02622:Ddx60 APN 8 62,395,470 (GRCm39) splice site probably null
IGL02657:Ddx60 APN 8 62,437,149 (GRCm39) missense probably benign 0.01
IGL02677:Ddx60 APN 8 62,441,166 (GRCm39) missense probably damaging 1.00
IGL02701:Ddx60 APN 8 62,432,375 (GRCm39) missense probably damaging 0.96
IGL02806:Ddx60 APN 8 62,409,156 (GRCm39) missense probably benign 0.00
IGL03137:Ddx60 APN 8 62,441,117 (GRCm39) missense possibly damaging 0.61
IGL03295:Ddx60 APN 8 62,409,155 (GRCm39) missense possibly damaging 0.82
IGL03387:Ddx60 APN 8 62,465,483 (GRCm39) missense probably damaging 1.00
IGL03411:Ddx60 APN 8 62,430,916 (GRCm39) critical splice acceptor site probably null
Scatter UTSW 8 62,474,348 (GRCm39) missense possibly damaging 0.80
shotgun UTSW 8 62,490,101 (GRCm39) missense probably benign 0.28
splay UTSW 8 62,474,343 (GRCm39) missense possibly damaging 0.80
G1Funyon:Ddx60 UTSW 8 62,453,631 (GRCm39) missense probably benign 0.01
PIT4504001:Ddx60 UTSW 8 62,411,147 (GRCm39) missense probably benign
PIT4677001:Ddx60 UTSW 8 62,425,288 (GRCm39) missense possibly damaging 0.87
R0090:Ddx60 UTSW 8 62,395,327 (GRCm39) missense probably damaging 1.00
R0266:Ddx60 UTSW 8 62,486,527 (GRCm39) missense possibly damaging 0.92
R0325:Ddx60 UTSW 8 62,436,889 (GRCm39) missense probably benign 0.00
R0367:Ddx60 UTSW 8 62,470,783 (GRCm39) missense possibly damaging 0.78
R0403:Ddx60 UTSW 8 62,447,575 (GRCm39) splice site probably benign
R0479:Ddx60 UTSW 8 62,422,691 (GRCm39) missense probably damaging 1.00
R0561:Ddx60 UTSW 8 62,470,828 (GRCm39) missense possibly damaging 0.93
R0844:Ddx60 UTSW 8 62,440,395 (GRCm39) missense probably benign 0.27
R1119:Ddx60 UTSW 8 62,395,578 (GRCm39) missense probably damaging 1.00
R1428:Ddx60 UTSW 8 62,411,193 (GRCm39) splice site probably benign
R1778:Ddx60 UTSW 8 62,427,210 (GRCm39) missense possibly damaging 0.85
R1840:Ddx60 UTSW 8 62,422,587 (GRCm39) missense probably damaging 0.99
R1964:Ddx60 UTSW 8 62,401,903 (GRCm39) missense probably benign 0.10
R1970:Ddx60 UTSW 8 62,425,240 (GRCm39) missense possibly damaging 0.93
R2101:Ddx60 UTSW 8 62,393,679 (GRCm39) missense probably damaging 1.00
R2174:Ddx60 UTSW 8 62,470,234 (GRCm39) missense probably benign 0.01
R2174:Ddx60 UTSW 8 62,409,175 (GRCm39) missense probably damaging 1.00
R2198:Ddx60 UTSW 8 62,411,097 (GRCm39) missense possibly damaging 0.79
R2332:Ddx60 UTSW 8 62,490,125 (GRCm39) missense probably benign 0.08
R2338:Ddx60 UTSW 8 62,465,470 (GRCm39) missense possibly damaging 0.91
R2379:Ddx60 UTSW 8 62,490,122 (GRCm39) missense probably damaging 1.00
R4010:Ddx60 UTSW 8 62,409,178 (GRCm39) missense probably benign 0.25
R4010:Ddx60 UTSW 8 62,407,569 (GRCm39) missense possibly damaging 0.65
R4133:Ddx60 UTSW 8 62,425,254 (GRCm39) missense probably damaging 0.99
R4282:Ddx60 UTSW 8 62,447,427 (GRCm39) missense probably damaging 0.99
R4382:Ddx60 UTSW 8 62,402,012 (GRCm39) splice site probably null
R4561:Ddx60 UTSW 8 62,395,495 (GRCm39) missense probably damaging 0.96
R4572:Ddx60 UTSW 8 62,440,455 (GRCm39) missense probably damaging 1.00
R4581:Ddx60 UTSW 8 62,476,295 (GRCm39) missense possibly damaging 0.90
R4635:Ddx60 UTSW 8 62,490,101 (GRCm39) missense probably benign 0.28
R4698:Ddx60 UTSW 8 62,465,458 (GRCm39) missense probably benign 0.01
R4807:Ddx60 UTSW 8 62,432,372 (GRCm39) missense probably damaging 1.00
R4858:Ddx60 UTSW 8 62,474,348 (GRCm39) missense possibly damaging 0.80
R4964:Ddx60 UTSW 8 62,432,372 (GRCm39) missense probably damaging 1.00
R5120:Ddx60 UTSW 8 62,398,940 (GRCm39) missense probably benign 0.01
R5187:Ddx60 UTSW 8 62,427,222 (GRCm39) missense probably damaging 1.00
R5222:Ddx60 UTSW 8 62,437,192 (GRCm39) missense probably damaging 0.99
R5400:Ddx60 UTSW 8 62,463,036 (GRCm39) missense possibly damaging 0.65
R5500:Ddx60 UTSW 8 62,403,485 (GRCm39) missense probably benign 0.28
R5514:Ddx60 UTSW 8 62,411,091 (GRCm39) missense probably damaging 1.00
R5668:Ddx60 UTSW 8 62,453,612 (GRCm39) missense probably benign 0.38
R5742:Ddx60 UTSW 8 62,401,955 (GRCm39) missense probably benign
R5772:Ddx60 UTSW 8 62,401,931 (GRCm39) missense probably damaging 1.00
R5810:Ddx60 UTSW 8 62,465,422 (GRCm39) nonsense probably null
R5815:Ddx60 UTSW 8 62,416,756 (GRCm39) missense probably damaging 0.98
R5820:Ddx60 UTSW 8 62,409,155 (GRCm39) missense possibly damaging 0.82
R5866:Ddx60 UTSW 8 62,393,774 (GRCm39) missense probably damaging 1.00
R5881:Ddx60 UTSW 8 62,490,104 (GRCm39) missense probably damaging 1.00
R5977:Ddx60 UTSW 8 62,474,444 (GRCm39) critical splice donor site probably null
R6048:Ddx60 UTSW 8 62,453,616 (GRCm39) missense probably benign 0.01
R6061:Ddx60 UTSW 8 62,476,275 (GRCm39) missense probably null 0.01
R6153:Ddx60 UTSW 8 62,398,974 (GRCm39) missense possibly damaging 0.47
R6287:Ddx60 UTSW 8 62,403,612 (GRCm39) missense probably damaging 1.00
R6415:Ddx60 UTSW 8 62,436,939 (GRCm39) missense probably benign 0.00
R6416:Ddx60 UTSW 8 62,451,715 (GRCm39) missense probably benign
R6660:Ddx60 UTSW 8 62,409,273 (GRCm39) missense probably benign 0.00
R6694:Ddx60 UTSW 8 62,490,104 (GRCm39) missense probably damaging 1.00
R6715:Ddx60 UTSW 8 62,436,924 (GRCm39) missense probably benign 0.03
R6720:Ddx60 UTSW 8 62,453,723 (GRCm39) missense probably benign 0.10
R6937:Ddx60 UTSW 8 62,490,103 (GRCm39) missense probably damaging 1.00
R7153:Ddx60 UTSW 8 62,441,142 (GRCm39) missense possibly damaging 0.71
R7274:Ddx60 UTSW 8 62,393,142 (GRCm39) critical splice donor site probably null
R7409:Ddx60 UTSW 8 62,411,612 (GRCm39) missense probably benign 0.24
R7464:Ddx60 UTSW 8 62,393,708 (GRCm39) missense possibly damaging 0.82
R7670:Ddx60 UTSW 8 62,428,826 (GRCm39) missense probably damaging 1.00
R7904:Ddx60 UTSW 8 62,430,924 (GRCm39) missense possibly damaging 0.81
R7992:Ddx60 UTSW 8 62,407,569 (GRCm39) missense probably benign 0.03
R8124:Ddx60 UTSW 8 62,436,945 (GRCm39) missense probably benign
R8125:Ddx60 UTSW 8 62,436,945 (GRCm39) missense probably benign
R8126:Ddx60 UTSW 8 62,436,945 (GRCm39) missense probably benign
R8155:Ddx60 UTSW 8 62,470,205 (GRCm39) missense possibly damaging 0.61
R8174:Ddx60 UTSW 8 62,470,284 (GRCm39) splice site probably null
R8192:Ddx60 UTSW 8 62,431,002 (GRCm39) missense probably damaging 1.00
R8271:Ddx60 UTSW 8 62,393,142 (GRCm39) critical splice donor site probably null
R8301:Ddx60 UTSW 8 62,453,631 (GRCm39) missense probably benign 0.01
R8304:Ddx60 UTSW 8 62,451,803 (GRCm39) missense possibly damaging 0.67
R8319:Ddx60 UTSW 8 62,395,669 (GRCm39) critical splice donor site probably null
R8374:Ddx60 UTSW 8 62,427,205 (GRCm39) missense probably benign 0.01
R8401:Ddx60 UTSW 8 62,409,277 (GRCm39) missense possibly damaging 0.57
R8487:Ddx60 UTSW 8 62,427,184 (GRCm39) missense probably damaging 1.00
R8804:Ddx60 UTSW 8 62,411,640 (GRCm39) missense probably benign 0.27
R8826:Ddx60 UTSW 8 62,398,990 (GRCm39) missense probably benign 0.02
R8829:Ddx60 UTSW 8 62,393,695 (GRCm39) missense probably damaging 1.00
R8881:Ddx60 UTSW 8 62,474,343 (GRCm39) missense possibly damaging 0.80
R8884:Ddx60 UTSW 8 62,447,553 (GRCm39) missense possibly damaging 0.86
R8990:Ddx60 UTSW 8 62,427,168 (GRCm39) nonsense probably null
R9122:Ddx60 UTSW 8 62,442,898 (GRCm39) missense probably benign 0.16
R9225:Ddx60 UTSW 8 62,470,875 (GRCm39) missense probably benign 0.36
R9278:Ddx60 UTSW 8 62,431,012 (GRCm39) missense possibly damaging 0.83
R9293:Ddx60 UTSW 8 62,462,994 (GRCm39) missense possibly damaging 0.89
R9405:Ddx60 UTSW 8 62,425,248 (GRCm39) missense probably benign 0.03
R9766:Ddx60 UTSW 8 62,465,312 (GRCm39) missense probably damaging 1.00
X0003:Ddx60 UTSW 8 62,486,451 (GRCm39) missense possibly damaging 0.88
X0019:Ddx60 UTSW 8 62,416,726 (GRCm39) missense probably benign 0.01
Z1177:Ddx60 UTSW 8 62,453,622 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GGACATATCTTCTCTCATACTTGGATC -3'
(R):5'- TTGTCCCTCACAAATTCAAAGG -3'

Sequencing Primer
(F):5'- CTGGAATTCACTCTGTAGACCAGG -3'
(R):5'- CAAAGGAATTATTTTCACGGGCC -3'
Posted On 2018-05-24