Incidental Mutation 'R6416:Tecta'
ID517940
Institutional Source Beutler Lab
Gene Symbol Tecta
Ensembl Gene ENSMUSG00000037705
Gene Nametectorin alpha
Synonyms[a]-tectorin, Tctna
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R6416 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location42329619-42399929 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 42375267 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 698 (V698M)
Ref Sequence ENSEMBL: ENSMUSP00000125370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042190] [ENSMUST00000160940]
Predicted Effect probably damaging
Transcript: ENSMUST00000042190
AA Change: V698M

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000040262
Gene: ENSMUSG00000037705
AA Change: V698M

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
NIDO 98 254 7.88e-77 SMART
VWC 260 314 1.04e0 SMART
VWD 312 477 1.5e-58 SMART
C8 517 592 7.06e-29 SMART
EGF_like 622 645 3.87e1 SMART
VWC 652 713 1.87e-1 SMART
VWD 703 865 4.44e-43 SMART
C8 905 981 9.19e-19 SMART
Pfam:TIL 984 1036 9.8e-13 PFAM
VWD 1090 1257 1.44e-51 SMART
C8 1294 1369 4.64e-15 SMART
EGF_like 1388 1420 5.34e1 SMART
VWC 1427 1487 2.88e-19 SMART
VWD 1477 1638 2.72e-38 SMART
C8 1684 1758 6.51e-10 SMART
ZP 1805 2059 2.95e-85 SMART
EGF 2087 2122 2.07e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160940
AA Change: V698M

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125370
Gene: ENSMUSG00000037705
AA Change: V698M

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
NIDO 98 254 7.88e-77 SMART
VWC 260 314 1.04e0 SMART
VWD 312 477 1.5e-58 SMART
C8 517 592 7.06e-29 SMART
EGF_like 622 645 3.87e1 SMART
VWC 652 713 1.87e-1 SMART
VWD 703 865 4.44e-43 SMART
C8 905 981 9.19e-19 SMART
Pfam:TIL 984 1036 6.1e-13 PFAM
VWD 1090 1257 1.44e-51 SMART
C8 1294 1369 4.64e-15 SMART
EGF_like 1388 1420 5.34e1 SMART
VWC 1427 1487 2.88e-19 SMART
VWD 1477 1638 2.72e-38 SMART
C8 1679 1753 6.51e-10 SMART
ZP 1800 2054 2.95e-85 SMART
EGF 2082 2117 2.07e1 SMART
Meta Mutation Damage Score 0.1543 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.4%
  • 20x: 94.6%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The tectorial membrane is an extracellular matrix of the inner ear that contacts the stereocilia bundles of specialized sensory hair cells. Sound induces movement of these hair cells relative to the tectorial membrane, deflects the stereocilia, and leads to fluctuations in hair-cell membrane potential, transducing sound into electrical signals. Alpha-tectorin is one of the major noncollagenous components of the tectorial membrane. Mutations in the TECTA gene have been shown to be responsible for autosomal dominant nonsyndromic hearing impairment and a recessive form of sensorineural pre-lingual non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit a tectorial membrane that is detached from the cochlear epithelium. Though the basilar membranes of mutant mice are tuned, sensitivity is attenuated. Mice with an Y1870C mutation have a disrupted tectorial membrane, elevated neural thresholds and broadened neural tuning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik C A 16: 88,707,891 R6L unknown Het
Anxa11 A G 14: 25,874,270 Q235R possibly damaging Het
Ap2b1 T A 11: 83,308,239 M1K probably null Het
Atl2 G A 17: 79,850,223 T563I probably benign Het
Azin1 A T 15: 38,492,343 S307R possibly damaging Het
Ccdc153 A G 9: 44,245,780 T118A probably benign Het
Chac1 G A 2: 119,353,534 V206I probably damaging Het
Chrm3 A G 13: 9,877,662 V446A probably benign Het
Cped1 T C 6: 22,123,649 F467S probably damaging Het
Csmd3 G A 15: 48,673,560 P82L probably damaging Het
Ddx60 T A 8: 61,977,950 S840T probably benign Het
Ddx60 C T 8: 61,998,681 H1202Y probably benign Het
Dnah8 T A 17: 30,765,635 N3102K probably benign Het
Dst A T 1: 34,116,128 K85M probably damaging Het
Ehbp1l1 T C 19: 5,718,757 I839M probably benign Het
Fam184b T A 5: 45,537,653 M750L probably benign Het
Frem2 T C 3: 53,572,378 T1965A probably benign Het
Ftl1 A T 7: 45,459,210 D41E probably benign Het
Garem2 G A 5: 30,116,737 W698* probably null Het
Glt8d2 T C 10: 82,652,906 Y283C probably damaging Het
Hars T C 18: 36,773,590 E109G possibly damaging Het
Hspb9 T C 11: 100,714,210 S121P probably damaging Het
Hus1b A T 13: 30,947,205 L157Q probably damaging Het
Hykk A G 9: 54,946,359 M322V probably benign Het
Igkv4-61 C A 6: 69,417,154 A31S possibly damaging Het
Il17f T A 1: 20,777,907 M116L probably benign Het
Kif22 T C 7: 127,028,932 K9E possibly damaging Het
Krt90 T C 15: 101,559,244 E233G probably benign Het
Lipg T C 18: 74,957,236 M81V probably benign Het
Mocos C T 18: 24,701,456 S850L probably damaging Het
Mug2 T A 6: 122,082,754 S1364T probably damaging Het
Neb A T 2: 52,185,328 N208K probably benign Het
Oca2 G T 7: 56,328,767 R561L probably benign Het
Olfm5 A G 7: 104,154,053 L401P probably damaging Het
Olfr109 T A 17: 37,467,080 Y291* probably null Het
Olfr1238 C A 2: 89,406,522 A186S possibly damaging Het
Olfr331 T C 11: 58,502,340 D72G probably damaging Het
Olfr828 G A 9: 18,815,892 T134M probably benign Het
Olfr952 T A 9: 39,426,891 Y60F probably damaging Het
Oxgr1 T C 14: 120,022,448 N116D probably damaging Het
Pcdha11 G T 18: 37,012,169 probably null Het
Pi4ka T C 16: 17,358,322 I418V probably benign Het
Pih1d2 T C 9: 50,618,609 V62A probably benign Het
Pkib T A 10: 57,728,138 V46E probably damaging Het
Pum1 A G 4: 130,728,287 probably null Het
Rbak G T 5: 143,176,552 Q19K possibly damaging Het
Sema3c A G 5: 17,576,961 T32A probably damaging Het
Shprh T C 10: 11,167,873 W835R probably damaging Het
Sis T G 3: 72,911,854 K1456N probably damaging Het
Slc4a4 A T 5: 89,179,729 N675I probably benign Het
Slc8a3 C A 12: 81,315,627 M139I probably damaging Het
Sorcs3 T C 19: 48,802,759 F1182S probably damaging Het
St8sia2 A T 7: 73,971,921 I96N probably damaging Het
Stx19 T C 16: 62,822,057 S79P probably damaging Het
Timm22 T C 11: 76,411,139 S150P probably damaging Het
Tjp1 C T 7: 65,313,205 D995N possibly damaging Het
Tmem135 T A 7: 89,147,794 T365S probably benign Het
Tmem174 T C 13: 98,636,981 T114A probably benign Het
Tnc A G 4: 64,007,816 I909T probably benign Het
Trcg1 A G 9: 57,241,330 I62V possibly damaging Het
Tulp1 A T 17: 28,356,031 *487K probably null Het
Unc79 T A 12: 103,131,646 V1826E possibly damaging Het
Vmn2r13 A T 5: 109,174,116 N238K probably damaging Het
Vmn2r22 T A 6: 123,637,738 N298Y probably damaging Het
Vmn2r23 T A 6: 123,712,902 F246I probably damaging Het
Vps9d1 A C 8: 123,248,639 V194G probably damaging Het
Zfp260 A T 7: 30,104,810 H45L possibly damaging Het
Zfp846 A T 9: 20,593,720 H292L possibly damaging Het
Other mutations in Tecta
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Tecta APN 9 42332548 missense probably damaging 1.00
IGL00925:Tecta APN 9 42375035 missense probably benign
IGL00960:Tecta APN 9 42359080 missense possibly damaging 0.74
IGL00974:Tecta APN 9 42331374 missense probably benign 0.00
IGL01070:Tecta APN 9 42395003 missense probably damaging 1.00
IGL01284:Tecta APN 9 42345620 missense probably damaging 1.00
IGL01324:Tecta APN 9 42345431 missense probably damaging 1.00
IGL01694:Tecta APN 9 42367179 missense possibly damaging 0.92
IGL01861:Tecta APN 9 42373362 missense probably benign
IGL02010:Tecta APN 9 42337193 missense probably damaging 0.97
IGL02397:Tecta APN 9 42394998 missense probably damaging 1.00
IGL03031:Tecta APN 9 42345493 missense probably benign
IGL03208:Tecta APN 9 42337100 splice site probably benign
IGL03249:Tecta APN 9 42391886 missense probably benign 0.20
R0004:Tecta UTSW 9 42345478 missense possibly damaging 0.74
R0045:Tecta UTSW 9 42375191 missense probably damaging 1.00
R0045:Tecta UTSW 9 42375191 missense probably damaging 1.00
R0119:Tecta UTSW 9 42352063 missense probably damaging 1.00
R0133:Tecta UTSW 9 42367228 missense probably benign 0.00
R0157:Tecta UTSW 9 42375011 missense probably benign
R0180:Tecta UTSW 9 42366813 missense probably benign
R0299:Tecta UTSW 9 42352063 missense probably damaging 1.00
R0345:Tecta UTSW 9 42384218 missense probably damaging 0.98
R0370:Tecta UTSW 9 42366804 missense probably benign
R0465:Tecta UTSW 9 42359418 missense possibly damaging 0.62
R0466:Tecta UTSW 9 42373073 missense probably benign
R0479:Tecta UTSW 9 42337939 missense probably damaging 1.00
R0498:Tecta UTSW 9 42377614 missense probably damaging 1.00
R0499:Tecta UTSW 9 42352063 missense probably damaging 1.00
R0519:Tecta UTSW 9 42347892 splice site probably benign
R0584:Tecta UTSW 9 42347908 missense possibly damaging 0.79
R0589:Tecta UTSW 9 42345634 missense probably benign 0.01
R0607:Tecta UTSW 9 42388205 missense probably damaging 1.00
R0691:Tecta UTSW 9 42384341 missense probably damaging 1.00
R0905:Tecta UTSW 9 42338994 missense probably damaging 1.00
R1216:Tecta UTSW 9 42377907 missense probably benign 0.44
R1239:Tecta UTSW 9 42332485 missense probably damaging 1.00
R1442:Tecta UTSW 9 42332482 missense probably damaging 1.00
R1553:Tecta UTSW 9 42348186 missense probably damaging 1.00
R1727:Tecta UTSW 9 42359301 missense probably damaging 0.96
R1728:Tecta UTSW 9 42391922 missense probably benign 0.12
R1729:Tecta UTSW 9 42391922 missense probably benign 0.12
R1762:Tecta UTSW 9 42375309 missense probably benign 0.30
R1778:Tecta UTSW 9 42343631 missense probably damaging 1.00
R1795:Tecta UTSW 9 42378049 missense probably benign
R1796:Tecta UTSW 9 42384197 missense probably damaging 1.00
R1866:Tecta UTSW 9 42392024 missense probably damaging 0.97
R1871:Tecta UTSW 9 42337176 missense probably damaging 0.98
R1871:Tecta UTSW 9 42337340 missense probably damaging 1.00
R1911:Tecta UTSW 9 42337936 missense probably damaging 1.00
R2074:Tecta UTSW 9 42337279 nonsense probably null
R2135:Tecta UTSW 9 42340285 missense probably damaging 1.00
R2171:Tecta UTSW 9 42358924 missense probably damaging 0.99
R2220:Tecta UTSW 9 42392030 missense probably damaging 1.00
R2372:Tecta UTSW 9 42388274 missense probably damaging 1.00
R2570:Tecta UTSW 9 42332552 missense probably damaging 1.00
R2939:Tecta UTSW 9 42377994 missense possibly damaging 0.63
R2940:Tecta UTSW 9 42377994 missense possibly damaging 0.63
R3081:Tecta UTSW 9 42377994 missense possibly damaging 0.63
R3407:Tecta UTSW 9 42337854 missense probably damaging 1.00
R3732:Tecta UTSW 9 42392106 missense possibly damaging 0.95
R3771:Tecta UTSW 9 42330996 missense probably damaging 1.00
R3772:Tecta UTSW 9 42330996 missense probably damaging 1.00
R3773:Tecta UTSW 9 42330996 missense probably damaging 1.00
R3832:Tecta UTSW 9 42339033 missense probably damaging 1.00
R4378:Tecta UTSW 9 42366708 missense probably damaging 1.00
R4480:Tecta UTSW 9 42373233 missense possibly damaging 0.75
R4485:Tecta UTSW 9 42337274 missense possibly damaging 0.73
R4804:Tecta UTSW 9 42398237 missense probably benign
R4869:Tecta UTSW 9 42375534 missense probably benign 0.02
R4944:Tecta UTSW 9 42330277 missense probably benign 0.05
R5008:Tecta UTSW 9 42373062 missense possibly damaging 0.76
R5014:Tecta UTSW 9 42373242 missense probably damaging 1.00
R5125:Tecta UTSW 9 42375185 missense probably damaging 1.00
R5178:Tecta UTSW 9 42375185 missense probably damaging 1.00
R5180:Tecta UTSW 9 42337208 missense probably damaging 1.00
R5214:Tecta UTSW 9 42345668 missense probably benign 0.04
R5230:Tecta UTSW 9 42394943 missense probably damaging 0.96
R5330:Tecta UTSW 9 42337856 missense probably damaging 1.00
R5387:Tecta UTSW 9 42375063 missense probably damaging 0.98
R5614:Tecta UTSW 9 42339055 missense probably damaging 1.00
R5708:Tecta UTSW 9 42338926 missense probably damaging 1.00
R5738:Tecta UTSW 9 42373178 missense possibly damaging 0.63
R5770:Tecta UTSW 9 42345589 missense possibly damaging 0.94
R5839:Tecta UTSW 9 42331023 missense probably benign 0.03
R5839:Tecta UTSW 9 42372976 missense possibly damaging 0.86
R6119:Tecta UTSW 9 42373075 missense probably benign 0.00
R6246:Tecta UTSW 9 42377908 missense probably benign 0.07
R6377:Tecta UTSW 9 42343755 missense probably damaging 1.00
R6595:Tecta UTSW 9 42384227 missense probably damaging 1.00
R6850:Tecta UTSW 9 42343838 missense probably benign 0.20
R6859:Tecta UTSW 9 42392129 missense probably damaging 1.00
R6861:Tecta UTSW 9 42337337 missense possibly damaging 0.93
R6939:Tecta UTSW 9 42347997 missense probably damaging 1.00
R6996:Tecta UTSW 9 42366786 missense probably benign
R7069:Tecta UTSW 9 42394941 missense probably benign 0.03
R7104:Tecta UTSW 9 42366943 missense probably benign 0.00
R7129:Tecta UTSW 9 42347991 missense probably damaging 1.00
R7220:Tecta UTSW 9 42343887 missense probably benign 0.05
R7251:Tecta UTSW 9 42387752 missense probably damaging 1.00
R7307:Tecta UTSW 9 42377992 missense probably damaging 1.00
R7343:Tecta UTSW 9 42337332 missense probably damaging 1.00
R7355:Tecta UTSW 9 42367142 nonsense probably null
R7635:Tecta UTSW 9 42330987 missense probably benign 0.11
R7653:Tecta UTSW 9 42337236 missense probably damaging 1.00
R7723:Tecta UTSW 9 42366936 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGTCAATTTCCAAGTACTCAGG -3'
(R):5'- TCTCAGAACTGTGCCACTCC -3'

Sequencing Primer
(F):5'- TTTCCAAGTACTCAGGACGCTCAG -3'
(R):5'- ACTCCATGCACGGAAGGTTG -3'
Posted On2018-05-24