Incidental Mutation 'R6416:Pih1d2'
ID517942
Institutional Source Beutler Lab
Gene Symbol Pih1d2
Ensembl Gene ENSMUSG00000000167
Gene NamePIH1 domain containing 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R6416 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location50617321-50625000 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50618609 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 62 (V62A)
Ref Sequence ENSEMBL: ENSMUSP00000122789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000171] [ENSMUST00000125606] [ENSMUST00000131351] [ENSMUST00000132187] [ENSMUST00000141366] [ENSMUST00000145139] [ENSMUST00000147671] [ENSMUST00000151197] [ENSMUST00000155435] [ENSMUST00000171462]
Predicted Effect probably benign
Transcript: ENSMUST00000000171
AA Change: V46A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000000171
Gene: ENSMUSG00000000167
AA Change: V46A

DomainStartEndE-ValueType
Pfam:PIH1 19 314 4.1e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124029
Predicted Effect probably benign
Transcript: ENSMUST00000125606
AA Change: V46A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121100
Gene: ENSMUSG00000000167
AA Change: V46A

DomainStartEndE-ValueType
Pfam:PIH1 19 140 2.1e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131351
SMART Domains Protein: ENSMUSP00000123319
Gene: ENSMUSG00000059820

DomainStartEndE-ValueType
low complexity region 142 175 N/A INTRINSIC
low complexity region 198 216 N/A INTRINSIC
low complexity region 224 256 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132187
AA Change: V46A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118064
Gene: ENSMUSG00000000167
AA Change: V46A

DomainStartEndE-ValueType
Pfam:PIH1 19 92 1.7e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141366
AA Change: V62A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000122789
Gene: ENSMUSG00000000167
AA Change: V62A

DomainStartEndE-ValueType
Pfam:PIH1 35 198 2.6e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145139
Predicted Effect probably benign
Transcript: ENSMUST00000147671
SMART Domains Protein: ENSMUSP00000117265
Gene: ENSMUSG00000059820

DomainStartEndE-ValueType
low complexity region 142 175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151197
AA Change: V46A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119253
Gene: ENSMUSG00000000167
AA Change: V46A

DomainStartEndE-ValueType
Pfam:PIH1 19 235 1.7e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155435
SMART Domains Protein: ENSMUSP00000121198
Gene: ENSMUSG00000059820

DomainStartEndE-ValueType
low complexity region 142 175 N/A INTRINSIC
low complexity region 198 214 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155773
Predicted Effect probably benign
Transcript: ENSMUST00000171462
SMART Domains Protein: ENSMUSP00000133259
Gene: ENSMUSG00000059820

DomainStartEndE-ValueType
Pfam:NKAP 86 163 5.2e-26 PFAM
low complexity region 198 216 N/A INTRINSIC
low complexity region 224 256 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.4%
  • 20x: 94.6%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik C A 16: 88,707,891 R6L unknown Het
Anxa11 A G 14: 25,874,270 Q235R possibly damaging Het
Ap2b1 T A 11: 83,308,239 M1K probably null Het
Atl2 G A 17: 79,850,223 T563I probably benign Het
Azin1 A T 15: 38,492,343 S307R possibly damaging Het
Ccdc153 A G 9: 44,245,780 T118A probably benign Het
Chac1 G A 2: 119,353,534 V206I probably damaging Het
Chrm3 A G 13: 9,877,662 V446A probably benign Het
Cped1 T C 6: 22,123,649 F467S probably damaging Het
Csmd3 G A 15: 48,673,560 P82L probably damaging Het
Ddx60 T A 8: 61,977,950 S840T probably benign Het
Ddx60 C T 8: 61,998,681 H1202Y probably benign Het
Dnah8 T A 17: 30,765,635 N3102K probably benign Het
Dst A T 1: 34,116,128 K85M probably damaging Het
Ehbp1l1 T C 19: 5,718,757 I839M probably benign Het
Fam184b T A 5: 45,537,653 M750L probably benign Het
Frem2 T C 3: 53,572,378 T1965A probably benign Het
Ftl1 A T 7: 45,459,210 D41E probably benign Het
Garem2 G A 5: 30,116,737 W698* probably null Het
Glt8d2 T C 10: 82,652,906 Y283C probably damaging Het
Hars T C 18: 36,773,590 E109G possibly damaging Het
Hspb9 T C 11: 100,714,210 S121P probably damaging Het
Hus1b A T 13: 30,947,205 L157Q probably damaging Het
Hykk A G 9: 54,946,359 M322V probably benign Het
Igkv4-61 C A 6: 69,417,154 A31S possibly damaging Het
Il17f T A 1: 20,777,907 M116L probably benign Het
Kif22 T C 7: 127,028,932 K9E possibly damaging Het
Krt90 T C 15: 101,559,244 E233G probably benign Het
Lipg T C 18: 74,957,236 M81V probably benign Het
Mocos C T 18: 24,701,456 S850L probably damaging Het
Mug2 T A 6: 122,082,754 S1364T probably damaging Het
Neb A T 2: 52,185,328 N208K probably benign Het
Oca2 G T 7: 56,328,767 R561L probably benign Het
Olfm5 A G 7: 104,154,053 L401P probably damaging Het
Olfr109 T A 17: 37,467,080 Y291* probably null Het
Olfr1238 C A 2: 89,406,522 A186S possibly damaging Het
Olfr331 T C 11: 58,502,340 D72G probably damaging Het
Olfr828 G A 9: 18,815,892 T134M probably benign Het
Olfr952 T A 9: 39,426,891 Y60F probably damaging Het
Oxgr1 T C 14: 120,022,448 N116D probably damaging Het
Pcdha11 G T 18: 37,012,169 probably null Het
Pi4ka T C 16: 17,358,322 I418V probably benign Het
Pkib T A 10: 57,728,138 V46E probably damaging Het
Pum1 A G 4: 130,728,287 probably null Het
Rbak G T 5: 143,176,552 Q19K possibly damaging Het
Sema3c A G 5: 17,576,961 T32A probably damaging Het
Shprh T C 10: 11,167,873 W835R probably damaging Het
Sis T G 3: 72,911,854 K1456N probably damaging Het
Slc4a4 A T 5: 89,179,729 N675I probably benign Het
Slc8a3 C A 12: 81,315,627 M139I probably damaging Het
Sorcs3 T C 19: 48,802,759 F1182S probably damaging Het
St8sia2 A T 7: 73,971,921 I96N probably damaging Het
Stx19 T C 16: 62,822,057 S79P probably damaging Het
Tecta C T 9: 42,375,267 V698M probably damaging Het
Timm22 T C 11: 76,411,139 S150P probably damaging Het
Tjp1 C T 7: 65,313,205 D995N possibly damaging Het
Tmem135 T A 7: 89,147,794 T365S probably benign Het
Tmem174 T C 13: 98,636,981 T114A probably benign Het
Tnc A G 4: 64,007,816 I909T probably benign Het
Trcg1 A G 9: 57,241,330 I62V possibly damaging Het
Tulp1 A T 17: 28,356,031 *487K probably null Het
Unc79 T A 12: 103,131,646 V1826E possibly damaging Het
Vmn2r13 A T 5: 109,174,116 N238K probably damaging Het
Vmn2r22 T A 6: 123,637,738 N298Y probably damaging Het
Vmn2r23 T A 6: 123,712,902 F246I probably damaging Het
Vps9d1 A C 8: 123,248,639 V194G probably damaging Het
Zfp260 A T 7: 30,104,810 H45L possibly damaging Het
Zfp846 A T 9: 20,593,720 H292L possibly damaging Het
Other mutations in Pih1d2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01819:Pih1d2 APN 9 50621877 missense probably benign 0.09
FR4449:Pih1d2 UTSW 9 50621627 frame shift probably null
R0390:Pih1d2 UTSW 9 50621046 missense probably damaging 1.00
R0443:Pih1d2 UTSW 9 50621103 missense possibly damaging 0.46
R1570:Pih1d2 UTSW 9 50621179 missense probably benign 0.06
R1874:Pih1d2 UTSW 9 50620945 missense possibly damaging 0.68
R2207:Pih1d2 UTSW 9 50621079 missense probably benign 0.17
R4667:Pih1d2 UTSW 9 50620952 nonsense probably null
R5806:Pih1d2 UTSW 9 50618450 unclassified probably benign
R5811:Pih1d2 UTSW 9 50621074 missense probably damaging 1.00
R5949:Pih1d2 UTSW 9 50624984 missense probably damaging 1.00
R6156:Pih1d2 UTSW 9 50621152 missense possibly damaging 0.88
R6711:Pih1d2 UTSW 9 50618010 start codon destroyed probably null
R7052:Pih1d2 UTSW 9 50621777 missense probably damaging 1.00
R7557:Pih1d2 UTSW 9 50624916 missense probably damaging 0.99
R7661:Pih1d2 UTSW 9 50618258 critical splice donor site probably null
R7770:Pih1d2 UTSW 9 50621801 missense not run
Predicted Primers PCR Primer
(F):5'- GGGCAGTAAATACCTTACATGC -3'
(R):5'- CTTCAGTGAAATCTTCCATGTGG -3'

Sequencing Primer
(F):5'- AAGTCCTGTCTCTCTGCAGG -3'
(R):5'- GAAATCTTCCATGTGGTTTCATTTTC -3'
Posted On2018-05-24