Incidental Mutation 'R6416:Olfr331'
ID517948
Institutional Source Beutler Lab
Gene Symbol Olfr331
Ensembl Gene ENSMUSG00000058807
Gene Nameolfactory receptor 331
SynonymsGA_x6K02T2NKPP-912840-913784, MOR275-4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R6416 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location58501598-58502572 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58502340 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 72 (D72G)
Ref Sequence ENSEMBL: ENSMUSP00000132693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081743] [ENSMUST00000170501]
Predicted Effect probably damaging
Transcript: ENSMUST00000081743
AA Change: D78G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080440
Gene: ENSMUSG00000058807
AA Change: D78G

DomainStartEndE-ValueType
Pfam:7tm_4 35 315 1e-42 PFAM
Pfam:7tm_1 45 299 1.8e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170501
AA Change: D72G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132693
Gene: ENSMUSG00000058807
AA Change: D72G

DomainStartEndE-ValueType
low complexity region 23 37 N/A INTRINSIC
Pfam:7tm_1 39 292 4.9e-28 PFAM
Pfam:7tm_4 141 285 3.6e-42 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.4%
  • 20x: 94.6%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik C A 16: 88,707,891 R6L unknown Het
Anxa11 A G 14: 25,874,270 Q235R possibly damaging Het
Ap2b1 T A 11: 83,308,239 M1K probably null Het
Atl2 G A 17: 79,850,223 T563I probably benign Het
Azin1 A T 15: 38,492,343 S307R possibly damaging Het
Ccdc153 A G 9: 44,245,780 T118A probably benign Het
Chac1 G A 2: 119,353,534 V206I probably damaging Het
Chrm3 A G 13: 9,877,662 V446A probably benign Het
Cped1 T C 6: 22,123,649 F467S probably damaging Het
Csmd3 G A 15: 48,673,560 P82L probably damaging Het
Ddx60 T A 8: 61,977,950 S840T probably benign Het
Ddx60 C T 8: 61,998,681 H1202Y probably benign Het
Dnah8 T A 17: 30,765,635 N3102K probably benign Het
Dst A T 1: 34,116,128 K85M probably damaging Het
Ehbp1l1 T C 19: 5,718,757 I839M probably benign Het
Fam184b T A 5: 45,537,653 M750L probably benign Het
Frem2 T C 3: 53,572,378 T1965A probably benign Het
Ftl1 A T 7: 45,459,210 D41E probably benign Het
Garem2 G A 5: 30,116,737 W698* probably null Het
Glt8d2 T C 10: 82,652,906 Y283C probably damaging Het
Hars T C 18: 36,773,590 E109G possibly damaging Het
Hspb9 T C 11: 100,714,210 S121P probably damaging Het
Hus1b A T 13: 30,947,205 L157Q probably damaging Het
Hykk A G 9: 54,946,359 M322V probably benign Het
Igkv4-61 C A 6: 69,417,154 A31S possibly damaging Het
Il17f T A 1: 20,777,907 M116L probably benign Het
Kif22 T C 7: 127,028,932 K9E possibly damaging Het
Krt90 T C 15: 101,559,244 E233G probably benign Het
Lipg T C 18: 74,957,236 M81V probably benign Het
Mocos C T 18: 24,701,456 S850L probably damaging Het
Mug2 T A 6: 122,082,754 S1364T probably damaging Het
Neb A T 2: 52,185,328 N208K probably benign Het
Oca2 G T 7: 56,328,767 R561L probably benign Het
Olfm5 A G 7: 104,154,053 L401P probably damaging Het
Olfr109 T A 17: 37,467,080 Y291* probably null Het
Olfr1238 C A 2: 89,406,522 A186S possibly damaging Het
Olfr828 G A 9: 18,815,892 T134M probably benign Het
Olfr952 T A 9: 39,426,891 Y60F probably damaging Het
Oxgr1 T C 14: 120,022,448 N116D probably damaging Het
Pcdha11 G T 18: 37,012,169 probably null Het
Pi4ka T C 16: 17,358,322 I418V probably benign Het
Pih1d2 T C 9: 50,618,609 V62A probably benign Het
Pkib T A 10: 57,728,138 V46E probably damaging Het
Pum1 A G 4: 130,728,287 probably null Het
Rbak G T 5: 143,176,552 Q19K possibly damaging Het
Sema3c A G 5: 17,576,961 T32A probably damaging Het
Shprh T C 10: 11,167,873 W835R probably damaging Het
Sis T G 3: 72,911,854 K1456N probably damaging Het
Slc4a4 A T 5: 89,179,729 N675I probably benign Het
Slc8a3 C A 12: 81,315,627 M139I probably damaging Het
Sorcs3 T C 19: 48,802,759 F1182S probably damaging Het
St8sia2 A T 7: 73,971,921 I96N probably damaging Het
Stx19 T C 16: 62,822,057 S79P probably damaging Het
Tecta C T 9: 42,375,267 V698M probably damaging Het
Timm22 T C 11: 76,411,139 S150P probably damaging Het
Tjp1 C T 7: 65,313,205 D995N possibly damaging Het
Tmem135 T A 7: 89,147,794 T365S probably benign Het
Tmem174 T C 13: 98,636,981 T114A probably benign Het
Tnc A G 4: 64,007,816 I909T probably benign Het
Trcg1 A G 9: 57,241,330 I62V possibly damaging Het
Tulp1 A T 17: 28,356,031 *487K probably null Het
Unc79 T A 12: 103,131,646 V1826E possibly damaging Het
Vmn2r13 A T 5: 109,174,116 N238K probably damaging Het
Vmn2r22 T A 6: 123,637,738 N298Y probably damaging Het
Vmn2r23 T A 6: 123,712,902 F246I probably damaging Het
Vps9d1 A C 8: 123,248,639 V194G probably damaging Het
Zfp260 A T 7: 30,104,810 H45L possibly damaging Het
Zfp846 A T 9: 20,593,720 H292L possibly damaging Het
Other mutations in Olfr331
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01124:Olfr331 APN 11 58502194 missense possibly damaging 0.89
IGL02458:Olfr331 APN 11 58502247 missense probably benign 0.20
IGL02971:Olfr331 APN 11 58502385 missense probably damaging 1.00
IGL03346:Olfr331 APN 11 58501755 missense possibly damaging 0.76
R0416:Olfr331 UTSW 11 58502396 missense unknown
R1547:Olfr331 UTSW 11 58501825 missense probably damaging 1.00
R1697:Olfr331 UTSW 11 58501676 missense probably damaging 1.00
R1717:Olfr331 UTSW 11 58502059 missense probably benign 0.09
R1721:Olfr331 UTSW 11 58501939 missense probably damaging 1.00
R2194:Olfr331 UTSW 11 58501642 missense probably damaging 0.97
R3606:Olfr331 UTSW 11 58502131 missense possibly damaging 0.49
R4457:Olfr331 UTSW 11 58502118 missense probably damaging 1.00
R4766:Olfr331 UTSW 11 58501668 missense probably damaging 1.00
R4858:Olfr331 UTSW 11 58501909 missense probably damaging 1.00
R5475:Olfr331 UTSW 11 58501605 missense probably benign 0.10
R5822:Olfr331 UTSW 11 58501638 missense possibly damaging 0.61
R6337:Olfr331 UTSW 11 58502012 nonsense probably null
R7101:Olfr331 UTSW 11 58502553 missense probably benign 0.00
R7108:Olfr331 UTSW 11 58502554 missense probably benign
RF035:Olfr331 UTSW 11 58502382 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GTGGTTCATGAGGACAGGATAC -3'
(R):5'- GTCAGATTTCACCCTGGTGG -3'

Sequencing Primer
(F):5'- CTGGAGTGGATGACAGATGGCC -3'
(R):5'- GGTGGGATTCTTCAGTCAATCCAAAC -3'
Posted On2018-05-24