Mutagenetix > Incidental Mutations

Incidental Mutation 'R6416:Ap2b1'

517950

Institutional Source

Beutler Lab

Gene Symbol

Ap2b1

Ensembl Gene

ENSMUSG00000035152

Gene Name

adaptor-related protein complex 2, beta 1 subunit

Synonyms

1300012O03Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6416 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

83299024-83405035 bp(+) (GRCm38)

Type of Mutation

start codon destroyed

DNA Base Change (assembly)

T to A at 83308239 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 1 (M1K)

Ref Sequence

ENSEMBL: ENSMUSP00000070714 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018875] [ENSMUST00000065692] [ENSMUST00000142680] [ENSMUST00000176430] [ENSMUST00000176523] [ENSMUST00000176944]

Predicted Effect

probably null
Transcript: ENSMUST00000018875
AA Change: M1K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000018875
Gene: ENSMUSG00000035152
AA Change: M1K

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	2.6e-173	PFAM
Pfam:HEAT_2	88	157	3.7e-8	PFAM
Pfam:Cnd1	99	268	2.1e-40	PFAM
Pfam:HEAT_2	124	219	1.4e-9	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	654	675	N/A	INTRINSIC
Alpha_adaptinC2	721	831	2.94e-18	SMART
B2-adapt-app_C	840	950	9.93e-56	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000065692
AA Change: M1K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000070714
Gene: ENSMUSG00000035152
AA Change: M1K

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	4.2e-173	PFAM
Pfam:HEAT_2	88	157	2.7e-8	PFAM
Pfam:Cnd1	99	268	1.5e-37	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	653	665	N/A	INTRINSIC
Alpha_adaptinC2	707	817	2.94e-18	SMART
B2-adapt-app_C	826	936	9.93e-56	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132178

Predicted Effect

probably null
Transcript: ENSMUST00000142680
AA Change: M1K

Predicted Effect

probably null
Transcript: ENSMUST00000176430
AA Change: M1K

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000134779
Gene: ENSMUSG00000035152
AA Change: M1K

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	4e-173	PFAM
Pfam:HEAT_2	88	157	2.8e-8	PFAM
Pfam:Cnd1	99	268	1.5e-37	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	654	675	N/A	INTRINSIC
Alpha_adaptinC2	721	831	2.94e-18	SMART
B2-adapt-app_C	840	936	7.22e-35	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000176523
AA Change: M1K

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000135445
Gene: ENSMUSG00000035152
AA Change: M1K

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	95	1.1e-26	PFAM
Pfam:Cnd1	69	230	1.5e-26	PFAM
Pfam:HEAT_2	85	182	5.1e-9	PFAM
Pfam:Adaptin_N	90	496	4e-125	PFAM
low complexity region	587	605	N/A	INTRINSIC
low complexity region	616	637	N/A	INTRINSIC
Alpha_adaptinC2	683	793	2.94e-18	SMART
B2-adapt-app_C	802	912	9.93e-56	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000176944
AA Change: M1K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000134798
Gene: ENSMUSG00000035152
AA Change: M1K

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	199	3.4e-67	PFAM
Pfam:DNA_alkylation	18	196	4.6e-8	PFAM
Pfam:HEAT_2	88	185	3.1e-13	PFAM
Pfam:Cnd1	99	198	4.2e-27	PFAM
Pfam:HEAT	122	151	1.4e-5	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.8%
10x: 98.4%
20x: 94.6%

Validation Efficiency

99% (67/68)

MGI Phenotype

PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310061N02Rik	C	A	16: 88,707,891	R6L	unknown	Het
Anxa11	A	G	14: 25,874,270	Q235R	possibly damaging	Het
Atl2	G	A	17: 79,850,223	T563I	probably benign	Het
Azin1	A	T	15: 38,492,343	S307R	possibly damaging	Het
Ccdc153	A	G	9: 44,245,780	T118A	probably benign	Het
Chac1	G	A	2: 119,353,534	V206I	probably damaging	Het
Chrm3	A	G	13: 9,877,662	V446A	probably benign	Het
Cped1	T	C	6: 22,123,649	F467S	probably damaging	Het
Csmd3	G	A	15: 48,673,560	P82L	probably damaging	Het
Ddx60	T	A	8: 61,977,950	S840T	probably benign	Het
Ddx60	C	T	8: 61,998,681	H1202Y	probably benign	Het
Dnah8	T	A	17: 30,765,635	N3102K	probably benign	Het
Dst	A	T	1: 34,116,128	K85M	probably damaging	Het
Ehbp1l1	T	C	19: 5,718,757	I839M	probably benign	Het
Fam184b	T	A	5: 45,537,653	M750L	probably benign	Het
Frem2	T	C	3: 53,572,378	T1965A	probably benign	Het
Ftl1	A	T	7: 45,459,210	D41E	probably benign	Het
Garem2	G	A	5: 30,116,737	W698*	probably null	Het
Glt8d2	T	C	10: 82,652,906	Y283C	probably damaging	Het
Hars	T	C	18: 36,773,590	E109G	possibly damaging	Het
Hspb9	T	C	11: 100,714,210	S121P	probably damaging	Het
Hus1b	A	T	13: 30,947,205	L157Q	probably damaging	Het
Hykk	A	G	9: 54,946,359	M322V	probably benign	Het
Igkv4-61	C	A	6: 69,417,154	A31S	possibly damaging	Het
Il17f	T	A	1: 20,777,907	M116L	probably benign	Het
Kif22	T	C	7: 127,028,932	K9E	possibly damaging	Het
Krt90	T	C	15: 101,559,244	E233G	probably benign	Het
Lipg	T	C	18: 74,957,236	M81V	probably benign	Het
Mocos	C	T	18: 24,701,456	S850L	probably damaging	Het
Mug2	T	A	6: 122,082,754	S1364T	probably damaging	Het
Neb	A	T	2: 52,185,328	N208K	probably benign	Het
Oca2	G	T	7: 56,328,767	R561L	probably benign	Het
Olfm5	A	G	7: 104,154,053	L401P	probably damaging	Het
Olfr109	T	A	17: 37,467,080	Y291*	probably null	Het
Olfr1238	C	A	2: 89,406,522	A186S	possibly damaging	Het
Olfr331	T	C	11: 58,502,340	D72G	probably damaging	Het
Olfr828	G	A	9: 18,815,892	T134M	probably benign	Het
Olfr952	T	A	9: 39,426,891	Y60F	probably damaging	Het
Oxgr1	T	C	14: 120,022,448	N116D	probably damaging	Het
Pcdha11	G	T	18: 37,012,169		probably null	Het
Pi4ka	T	C	16: 17,358,322	I418V	probably benign	Het
Pih1d2	T	C	9: 50,618,609	V62A	probably benign	Het
Pkib	T	A	10: 57,728,138	V46E	probably damaging	Het
Pum1	A	G	4: 130,728,287		probably null	Het
Rbak	G	T	5: 143,176,552	Q19K	possibly damaging	Het
Sema3c	A	G	5: 17,576,961	T32A	probably damaging	Het
Shprh	T	C	10: 11,167,873	W835R	probably damaging	Het
Sis	T	G	3: 72,911,854	K1456N	probably damaging	Het
Slc4a4	A	T	5: 89,179,729	N675I	probably benign	Het
Slc8a3	C	A	12: 81,315,627	M139I	probably damaging	Het
Sorcs3	T	C	19: 48,802,759	F1182S	probably damaging	Het
St8sia2	A	T	7: 73,971,921	I96N	probably damaging	Het
Stx19	T	C	16: 62,822,057	S79P	probably damaging	Het
Tecta	C	T	9: 42,375,267	V698M	probably damaging	Het
Timm22	T	C	11: 76,411,139	S150P	probably damaging	Het
Tjp1	C	T	7: 65,313,205	D995N	possibly damaging	Het
Tmem135	T	A	7: 89,147,794	T365S	probably benign	Het
Tmem174	T	C	13: 98,636,981	T114A	probably benign	Het
Tnc	A	G	4: 64,007,816	I909T	probably benign	Het
Trcg1	A	G	9: 57,241,330	I62V	possibly damaging	Het
Tulp1	A	T	17: 28,356,031	*487K	probably null	Het
Unc79	T	A	12: 103,131,646	V1826E	possibly damaging	Het
Vmn2r13	A	T	5: 109,174,116	N238K	probably damaging	Het
Vmn2r22	T	A	6: 123,637,738	N298Y	probably damaging	Het
Vmn2r23	T	A	6: 123,712,902	F246I	probably damaging	Het
Vps9d1	A	C	8: 123,248,639	V194G	probably damaging	Het
Zfp260	A	T	7: 30,104,810	H45L	possibly damaging	Het
Zfp846	A	T	9: 20,593,720	H292L	possibly damaging	Het

Other mutations in Ap2b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00864:Ap2b1	APN	11	83333158	missense	probably damaging	0.99
IGL01583:Ap2b1	APN	11	83324611	missense	possibly damaging	0.61
IGL01753:Ap2b1	APN	11	83321973	missense	probably damaging	1.00
IGL01992:Ap2b1	APN	11	83335530	missense	probably damaging	1.00
IGL02192:Ap2b1	APN	11	83346766	missense	possibly damaging	0.48
IGL02315:Ap2b1	APN	11	83336799	missense	probably damaging	0.96
IGL03235:Ap2b1	APN	11	83341384	missense	probably benign	0.41
P0045:Ap2b1	UTSW	11	83368026	missense	probably damaging	1.00
R0121:Ap2b1	UTSW	11	83321967	missense	possibly damaging	0.66
R0334:Ap2b1	UTSW	11	83367874	splice site	probably benign
R1222:Ap2b1	UTSW	11	83346738	missense	probably benign	0.06
R1297:Ap2b1	UTSW	11	83333109	missense	probably damaging	1.00
R1653:Ap2b1	UTSW	11	83346831	missense	probably damaging	1.00
R1719:Ap2b1	UTSW	11	83324604	missense	probably damaging	1.00
R1885:Ap2b1	UTSW	11	83390735	missense	probably damaging	0.99
R1886:Ap2b1	UTSW	11	83390735	missense	probably damaging	0.99
R1965:Ap2b1	UTSW	11	83346895	missense	probably benign	0.00
R1966:Ap2b1	UTSW	11	83346895	missense	probably benign	0.00
R2046:Ap2b1	UTSW	11	83336386	missense	probably benign	0.14
R2086:Ap2b1	UTSW	11	83351118	missense	possibly damaging	0.88
R2132:Ap2b1	UTSW	11	83324761	splice site	probably benign
R3615:Ap2b1	UTSW	11	83324565	missense	possibly damaging	0.84
R3616:Ap2b1	UTSW	11	83324565	missense	possibly damaging	0.84
R3983:Ap2b1	UTSW	11	83390716	missense	probably damaging	1.00
R4124:Ap2b1	UTSW	11	83365645	critical splice acceptor site	probably null
R4125:Ap2b1	UTSW	11	83365645	critical splice acceptor site	probably null
R4198:Ap2b1	UTSW	11	83342603	missense	probably damaging	1.00
R4202:Ap2b1	UTSW	11	83335604	critical splice donor site	probably null
R4543:Ap2b1	UTSW	11	83324650	missense	probably damaging	1.00
R4583:Ap2b1	UTSW	11	83397779	missense	probably benign	0.00
R4589:Ap2b1	UTSW	11	83333011	nonsense	probably null
R4916:Ap2b1	UTSW	11	83390706	missense	probably damaging	1.00
R5005:Ap2b1	UTSW	11	83339392	missense	probably damaging	1.00
R5385:Ap2b1	UTSW	11	83342601	missense	probably damaging	1.00
R5510:Ap2b1	UTSW	11	83336737	splice site	probably null
R5738:Ap2b1	UTSW	11	83336430	splice site	probably null
R6023:Ap2b1	UTSW	11	83335398	missense	probably damaging	0.99
R6269:Ap2b1	UTSW	11	83346673	missense	probably damaging	1.00
R6383:Ap2b1	UTSW	11	83346825	missense	probably damaging	1.00
R6502:Ap2b1	UTSW	11	83342679	missense	probably damaging	0.97
R6810:Ap2b1	UTSW	11	83335491	missense	possibly damaging	0.89
R6969:Ap2b1	UTSW	11	83389726	missense	probably damaging	0.99
R7238:Ap2b1	UTSW	11	83333122	missense	possibly damaging	0.91
R7241:Ap2b1	UTSW	11	83351105	missense	probably benign	0.16
R7429:Ap2b1	UTSW	11	83367998	missense	probably benign	0.00
R7588:Ap2b1	UTSW	11	83324522	missense	probably benign	0.00
R7635:Ap2b1	UTSW	11	83389728	missense	probably benign	0.09
R7651:Ap2b1	UTSW	11	83339430	critical splice donor site	probably null
R7753:Ap2b1	UTSW	11	83367907	nonsense	probably null
R8468:Ap2b1	UTSW	11	83351065	missense	probably damaging	1.00
X0064:Ap2b1	UTSW	11	83324569	missense	probably damaging	1.00
Z1177:Ap2b1	UTSW	11	83365753	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCAAGTTGCAGTTCTTATTTCCCG -3'
(R):5'- AGCATGTAAAGTCCCCTACACTTC -3'

Sequencing Primer
(F):5'- GTGCTGCTTGAACCACAAATG -3'
(R):5'- TAAAGTCCCCTACACTTCAATAAATG -3'

Posted On

2018-05-24