Mutagenetix > Incidental Mutation

Incidental Mutation 'R6416:Slc8a3'

517952

Institutional Source

Beutler Lab

Gene Symbol

Slc8a3

Ensembl Gene

ENSMUSG00000079055

Gene Name

solute carrier family 8 (sodium/calcium exchanger), member 3

Synonyms

Ncx3

MMRRC Submission

044558-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6416 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

81197915-81333180 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 81315627 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 139 (M139I)

Ref Sequence

ENSEMBL: ENSMUSP00000063258 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064594] [ENSMUST00000085238] [ENSMUST00000182208]

AlphaFold

S4R2P9

Predicted Effect

probably damaging
Transcript: ENSMUST00000064594
AA Change: M139I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000063258
Gene: ENSMUSG00000079055
AA Change: M139I

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	79	250	1.3e-36	PFAM
Pfam:Na_Ca_ex_C	253	379	4.6e-57	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.04e-40	SMART
low complexity region	712	723	N/A	INTRINSIC
Pfam:Na_Ca_ex	754	919	2e-27	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000085238
AA Change: M139I

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000082334
Gene: ENSMUSG00000079055
AA Change: M139I

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	79	250	1.3e-36	PFAM
Pfam:Na_Ca_ex_C	253	379	4.6e-57	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.54e-43	SMART
low complexity region	705	716	N/A	INTRINSIC
Pfam:Na_Ca_ex	747	912	1.9e-27	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000182208
AA Change: M139I

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000138735
Gene: ENSMUSG00000079055
AA Change: M139I

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	89	248	8.1e-38	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.04e-40	SMART
low complexity region	712	723	N/A	INTRINSIC
Pfam:Na_Ca_ex	764	917	9.1e-27	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183102

Coding Region Coverage

1x: 100.0%
3x: 99.8%
10x: 98.4%
20x: 94.6%

Validation Efficiency

99% (67/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium/calcium exchanger integral membrane protein family. Na+/Ca2+ exchange proteins are involved in maintaining Ca2+ homeostasis in a wide variety of cell types. The protein is regulated by intracellular calcium ions and is found in both the plasma membrane and intracellular organellar membranes, where exchange of Na+ for Ca2+ occurs in an electrogenic manner. Alternative splicing has been observed for this gene and multiple variants have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310061N02Rik	C	A	16: 88,707,891	R6L	unknown	Het
Anxa11	A	G	14: 25,874,270	Q235R	possibly damaging	Het
Ap2b1	T	A	11: 83,308,239	M1K	probably null	Het
Atl2	G	A	17: 79,850,223	T563I	probably benign	Het
Azin1	A	T	15: 38,492,343	S307R	possibly damaging	Het
Ccdc153	A	G	9: 44,245,780	T118A	probably benign	Het
Chac1	G	A	2: 119,353,534	V206I	probably damaging	Het
Chrm3	A	G	13: 9,877,662	V446A	probably benign	Het
Cped1	T	C	6: 22,123,649	F467S	probably damaging	Het
Csmd3	G	A	15: 48,673,560	P82L	probably damaging	Het
Ddx60	T	A	8: 61,977,950	S840T	probably benign	Het
Ddx60	C	T	8: 61,998,681	H1202Y	probably benign	Het
Dnah8	T	A	17: 30,765,635	N3102K	probably benign	Het
Dst	A	T	1: 34,116,128	K85M	probably damaging	Het
Ehbp1l1	T	C	19: 5,718,757	I839M	probably benign	Het
Fam184b	T	A	5: 45,537,653	M750L	probably benign	Het
Frem2	T	C	3: 53,572,378	T1965A	probably benign	Het
Ftl1	A	T	7: 45,459,210	D41E	probably benign	Het
Garem2	G	A	5: 30,116,737	W698*	probably null	Het
Glt8d2	T	C	10: 82,652,906	Y283C	probably damaging	Het
Hars	T	C	18: 36,773,590	E109G	possibly damaging	Het
Hspb9	T	C	11: 100,714,210	S121P	probably damaging	Het
Hus1b	A	T	13: 30,947,205	L157Q	probably damaging	Het
Hykk	A	G	9: 54,946,359	M322V	probably benign	Het
Igkv4-61	C	A	6: 69,417,154	A31S	possibly damaging	Het
Il17f	T	A	1: 20,777,907	M116L	probably benign	Het
Kif22	T	C	7: 127,028,932	K9E	possibly damaging	Het
Krt90	T	C	15: 101,559,244	E233G	probably benign	Het
Lipg	T	C	18: 74,957,236	M81V	probably benign	Het
Mocos	C	T	18: 24,701,456	S850L	probably damaging	Het
Mug2	T	A	6: 122,082,754	S1364T	probably damaging	Het
Neb	A	T	2: 52,185,328	N208K	probably benign	Het
Oca2	G	T	7: 56,328,767	R561L	probably benign	Het
Olfm5	A	G	7: 104,154,053	L401P	probably damaging	Het
Olfr109	T	A	17: 37,467,080	Y291*	probably null	Het
Olfr1238	C	A	2: 89,406,522	A186S	possibly damaging	Het
Olfr331	T	C	11: 58,502,340	D72G	probably damaging	Het
Olfr828	G	A	9: 18,815,892	T134M	probably benign	Het
Olfr952	T	A	9: 39,426,891	Y60F	probably damaging	Het
Oxgr1	T	C	14: 120,022,448	N116D	probably damaging	Het
Pcdha11	G	T	18: 37,012,169		probably null	Het
Pi4ka	T	C	16: 17,358,322	I418V	probably benign	Het
Pih1d2	T	C	9: 50,618,609	V62A	probably benign	Het
Pkib	T	A	10: 57,728,138	V46E	probably damaging	Het
Pum1	A	G	4: 130,728,287		probably null	Het
Rbak	G	T	5: 143,176,552	Q19K	possibly damaging	Het
Sema3c	A	G	5: 17,576,961	T32A	probably damaging	Het
Shprh	T	C	10: 11,167,873	W835R	probably damaging	Het
Sis	T	G	3: 72,911,854	K1456N	probably damaging	Het
Slc4a4	A	T	5: 89,179,729	N675I	probably benign	Het
Sorcs3	T	C	19: 48,802,759	F1182S	probably damaging	Het
St8sia2	A	T	7: 73,971,921	I96N	probably damaging	Het
Stx19	T	C	16: 62,822,057	S79P	probably damaging	Het
Tecta	C	T	9: 42,375,267	V698M	probably damaging	Het
Timm22	T	C	11: 76,411,139	S150P	probably damaging	Het
Tjp1	C	T	7: 65,313,205	D995N	possibly damaging	Het
Tmem135	T	A	7: 89,147,794	T365S	probably benign	Het
Tmem174	T	C	13: 98,636,981	T114A	probably benign	Het
Tnc	A	G	4: 64,007,816	I909T	probably benign	Het
Trcg1	A	G	9: 57,241,330	I62V	possibly damaging	Het
Tulp1	A	T	17: 28,356,031	*487K	probably null	Het
Unc79	T	A	12: 103,131,646	V1826E	possibly damaging	Het
Vmn2r13	A	T	5: 109,174,116	N238K	probably damaging	Het
Vmn2r22	T	A	6: 123,637,738	N298Y	probably damaging	Het
Vmn2r23	T	A	6: 123,712,902	F246I	probably damaging	Het
Vps9d1	A	C	8: 123,248,639	V194G	probably damaging	Het
Zfp260	A	T	7: 30,104,810	H45L	possibly damaging	Het
Zfp846	A	T	9: 20,593,720	H292L	possibly damaging	Het

Other mutations in Slc8a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00164:Slc8a3	APN	12	81314569	missense	probably benign
IGL01315:Slc8a3	APN	12	81314395	missense	probably damaging	0.97
IGL01365:Slc8a3	APN	12	81315376	missense	probably damaging	0.99
IGL01610:Slc8a3	APN	12	81315802	missense	probably damaging	1.00
IGL02227:Slc8a3	APN	12	81315683	missense	probably damaging	1.00
IGL02299:Slc8a3	APN	12	81315224	missense	probably damaging	0.98
IGL02548:Slc8a3	APN	12	81204156	splice site	probably benign
IGL02646:Slc8a3	APN	12	81315094	missense	probably damaging	1.00
IGL03135:Slc8a3	APN	12	81202249	missense	probably damaging	1.00
R0050:Slc8a3	UTSW	12	81315265	missense	probably damaging	1.00
R0627:Slc8a3	UTSW	12	81314842	missense	probably damaging	1.00
R0648:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R1342:Slc8a3	UTSW	12	81316016	missense	probably damaging	0.99
R1437:Slc8a3	UTSW	12	81315986	missense	probably damaging	0.99
R1470:Slc8a3	UTSW	12	81199710	missense	probably benign
R1470:Slc8a3	UTSW	12	81199710	missense	probably benign
R1557:Slc8a3	UTSW	12	81315557	missense	probably damaging	1.00
R1563:Slc8a3	UTSW	12	81205007	missense	possibly damaging	0.47
R1918:Slc8a3	UTSW	12	81314844	missense	probably damaging	0.99
R1930:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R1931:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R2232:Slc8a3	UTSW	12	81315220	missense	probably damaging	0.99
R2680:Slc8a3	UTSW	12	81202339	missense	probably damaging	0.99
R2941:Slc8a3	UTSW	12	81315179	missense	probably damaging	1.00
R3157:Slc8a3	UTSW	12	81314992	missense	probably damaging	1.00
R3159:Slc8a3	UTSW	12	81314992	missense	probably damaging	1.00
R3751:Slc8a3	UTSW	12	81204138	missense	probably damaging	1.00
R3859:Slc8a3	UTSW	12	81314872	missense	probably damaging	0.99
R4240:Slc8a3	UTSW	12	81315176	missense	probably damaging	0.99
R4527:Slc8a3	UTSW	12	81315853	missense	probably damaging	1.00
R4547:Slc8a3	UTSW	12	81314851	missense	possibly damaging	0.76
R4951:Slc8a3	UTSW	12	81314699	missense	probably benign	0.31
R4951:Slc8a3	UTSW	12	81315986	missense	probably damaging	0.99
R5022:Slc8a3	UTSW	12	81199558	missense	probably damaging	0.96
R5049:Slc8a3	UTSW	12	81214132	missense	probably damaging	1.00
R5057:Slc8a3	UTSW	12	81199558	missense	probably damaging	0.96
R5104:Slc8a3	UTSW	12	81214134	missense	probably null	0.34
R5122:Slc8a3	UTSW	12	81314258	critical splice donor site	probably null
R5183:Slc8a3	UTSW	12	81314491	missense	possibly damaging	0.79
R5629:Slc8a3	UTSW	12	81199631	missense	probably damaging	1.00
R6062:Slc8a3	UTSW	12	81314350	missense	probably damaging	1.00
R6218:Slc8a3	UTSW	12	81199567	missense	probably benign
R6279:Slc8a3	UTSW	12	81314978	missense	probably damaging	0.99
R6300:Slc8a3	UTSW	12	81314978	missense	probably damaging	0.99
R6790:Slc8a3	UTSW	12	81314432	missense	probably benign	0.00
R6999:Slc8a3	UTSW	12	81314755	missense	probably benign	0.06
R7195:Slc8a3	UTSW	12	81314273	missense	possibly damaging	0.95
R7268:Slc8a3	UTSW	12	81315053	missense	probably damaging	0.98
R7288:Slc8a3	UTSW	12	81216824	missense	possibly damaging	0.70
R7383:Slc8a3	UTSW	12	81315805	missense	probably damaging	1.00
R7392:Slc8a3	UTSW	12	81314803	missense	probably damaging	0.99
R7394:Slc8a3	UTSW	12	81214058	splice site	probably null
R7549:Slc8a3	UTSW	12	81314770	missense	probably benign	0.06
R7657:Slc8a3	UTSW	12	81314384	missense	probably damaging	1.00
R7699:Slc8a3	UTSW	12	81314473	missense	probably damaging	1.00
R7759:Slc8a3	UTSW	12	81314551	missense	probably benign
R7960:Slc8a3	UTSW	12	81216732	missense	probably benign	0.00
R7985:Slc8a3	UTSW	12	81314993	missense	probably damaging	1.00
R8059:Slc8a3	UTSW	12	81202258	missense	probably damaging	1.00
R8192:Slc8a3	UTSW	12	81199681	missense	probably damaging	1.00
R8397:Slc8a3	UTSW	12	81199768	missense	probably benign	0.45
R8413:Slc8a3	UTSW	12	81314678	missense	probably damaging	0.97
R8681:Slc8a3	UTSW	12	81315140	missense	probably benign
R9060:Slc8a3	UTSW	12	81214078	missense	probably benign	0.45
R9061:Slc8a3	UTSW	12	81216766	missense	probably damaging	0.99
R9267:Slc8a3	UTSW	12	81314434	missense	possibly damaging	0.77
R9416:Slc8a3	UTSW	12	81315064	missense	probably benign	0.06
R9519:Slc8a3	UTSW	12	81315552	missense	probably benign	0.30
R9531:Slc8a3	UTSW	12	81315223	missense	probably damaging	1.00
X0026:Slc8a3	UTSW	12	81315287	missense	probably benign	0.22
X0028:Slc8a3	UTSW	12	81314943	missense	probably damaging	1.00
Z1177:Slc8a3	UTSW	12	81314700	missense	possibly damaging	0.92
Z1177:Slc8a3	UTSW	12	81315876	missense	probably benign	0.13

Predicted Primers

PCR Primer
(F):5'- AGCCGTGACGAAGAAGACTC -3'
(R):5'- ACAAGATTGCCAGGGTCATTG -3'

Sequencing Primer
(F):5'- AAGACTCGCAGGTGCTTGATC -3'
(R):5'- TCTATTTTGTGGCCCTGATATACATG -3'

Posted On

2018-05-24