Incidental Mutation 'R6416:Hus1b'
ID 517955
Institutional Source Beutler Lab
Gene Symbol Hus1b
Ensembl Gene ENSMUSG00000076430
Gene Name HUS1 checkpoint clamp component B
Synonyms
MMRRC Submission 044558-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R6416 (G1)
Quality Score 183.009
Status Validated
Chromosome 13
Chromosomal Location 31130559-31131744 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 31131188 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 157 (L157Q)
Ref Sequence ENSEMBL: ENSMUSP00000100007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021785] [ENSMUST00000102943] [ENSMUST00000102946]
AlphaFold Q8K572
Predicted Effect probably benign
Transcript: ENSMUST00000021785
SMART Domains Protein: ENSMUSP00000021785
Gene: ENSMUSG00000021357

DomainStartEndE-ValueType
Pfam:TIG 8 92 3.2e-10 PFAM
Pfam:Sec5 198 377 3.6e-59 PFAM
low complexity region 572 585 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102943
AA Change: L157Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100007
Gene: ENSMUSG00000076430
AA Change: L157Q

DomainStartEndE-ValueType
Pfam:Hus1 1 276 1.5e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102946
SMART Domains Protein: ENSMUSP00000100010
Gene: ENSMUSG00000021357

DomainStartEndE-ValueType
Pfam:TIG 8 92 2.5e-10 PFAM
Pfam:Sec5 198 377 7.5e-59 PFAM
low complexity region 572 585 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223216
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.4%
  • 20x: 94.6%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is most closely related to HUS1, a component of a cell cycle checkpoint protein complex involved in cell cycle arrest in response to DNA damage. This protein can interact with the check point protein RAD1 but not with RAD9. Overexpression of this protein has been shown to induce cell death, which suggests a related but distinct role of this protein, as compared to the HUS1. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik C A 16: 88,504,779 (GRCm39) R6L unknown Het
Anxa11 A G 14: 25,874,694 (GRCm39) Q235R possibly damaging Het
Ap2b1 T A 11: 83,199,065 (GRCm39) M1K probably null Het
Atl2 G A 17: 80,157,652 (GRCm39) T563I probably benign Het
Azin1 A T 15: 38,492,587 (GRCm39) S307R possibly damaging Het
Ccdc153 A G 9: 44,157,077 (GRCm39) T118A probably benign Het
Chac1 G A 2: 119,184,015 (GRCm39) V206I probably damaging Het
Chrm3 A G 13: 9,927,698 (GRCm39) V446A probably benign Het
Cped1 T C 6: 22,123,648 (GRCm39) F467S probably damaging Het
Csmd3 G A 15: 48,536,956 (GRCm39) P82L probably damaging Het
Ddx60 T A 8: 62,430,984 (GRCm39) S840T probably benign Het
Ddx60 C T 8: 62,451,715 (GRCm39) H1202Y probably benign Het
Dnah8 T A 17: 30,984,609 (GRCm39) N3102K probably benign Het
Dst A T 1: 34,155,209 (GRCm39) K85M probably damaging Het
Ehbp1l1 T C 19: 5,768,785 (GRCm39) I839M probably benign Het
Fam184b T A 5: 45,694,995 (GRCm39) M750L probably benign Het
Frem2 T C 3: 53,479,799 (GRCm39) T1965A probably benign Het
Ftl1 A T 7: 45,108,634 (GRCm39) D41E probably benign Het
Garem2 G A 5: 30,321,735 (GRCm39) W698* probably null Het
Glt8d2 T C 10: 82,488,740 (GRCm39) Y283C probably damaging Het
Hars1 T C 18: 36,906,643 (GRCm39) E109G possibly damaging Het
Hspb9 T C 11: 100,605,036 (GRCm39) S121P probably damaging Het
Hykk A G 9: 54,853,643 (GRCm39) M322V probably benign Het
Igkv4-61 C A 6: 69,394,138 (GRCm39) A31S possibly damaging Het
Il17f T A 1: 20,848,131 (GRCm39) M116L probably benign Het
Kif22 T C 7: 126,628,104 (GRCm39) K9E possibly damaging Het
Krt90 T C 15: 101,467,679 (GRCm39) E233G probably benign Het
Lipg T C 18: 75,090,307 (GRCm39) M81V probably benign Het
Mocos C T 18: 24,834,513 (GRCm39) S850L probably damaging Het
Mug2 T A 6: 122,059,713 (GRCm39) S1364T probably damaging Het
Neb A T 2: 52,075,340 (GRCm39) N208K probably benign Het
Oca2 G T 7: 55,978,515 (GRCm39) R561L probably benign Het
Olfm5 A G 7: 103,803,260 (GRCm39) L401P probably damaging Het
Or12d17 T A 17: 37,777,971 (GRCm39) Y291* probably null Het
Or2t49 T C 11: 58,393,166 (GRCm39) D72G probably damaging Het
Or4a39 C A 2: 89,236,866 (GRCm39) A186S possibly damaging Het
Or7g16 G A 9: 18,727,188 (GRCm39) T134M probably benign Het
Or8g33 T A 9: 39,338,187 (GRCm39) Y60F probably damaging Het
Oxgr1 T C 14: 120,259,860 (GRCm39) N116D probably damaging Het
Pcdha11 G T 18: 37,145,222 (GRCm39) probably null Het
Pi4ka T C 16: 17,176,186 (GRCm39) I418V probably benign Het
Pih1d2 T C 9: 50,529,909 (GRCm39) V62A probably benign Het
Pkib T A 10: 57,604,234 (GRCm39) V46E probably damaging Het
Pum1 A G 4: 130,455,598 (GRCm39) probably null Het
Rbak G T 5: 143,162,307 (GRCm39) Q19K possibly damaging Het
Sema3c A G 5: 17,781,959 (GRCm39) T32A probably damaging Het
Shprh T C 10: 11,043,617 (GRCm39) W835R probably damaging Het
Sis T G 3: 72,819,187 (GRCm39) K1456N probably damaging Het
Slc4a4 A T 5: 89,327,588 (GRCm39) N675I probably benign Het
Slc8a3 C A 12: 81,362,401 (GRCm39) M139I probably damaging Het
Sorcs3 T C 19: 48,791,198 (GRCm39) F1182S probably damaging Het
St8sia2 A T 7: 73,621,669 (GRCm39) I96N probably damaging Het
Stx19 T C 16: 62,642,420 (GRCm39) S79P probably damaging Het
Tecta C T 9: 42,286,563 (GRCm39) V698M probably damaging Het
Timm22 T C 11: 76,301,965 (GRCm39) S150P probably damaging Het
Tjp1 C T 7: 64,962,953 (GRCm39) D995N possibly damaging Het
Tmem135 T A 7: 88,797,002 (GRCm39) T365S probably benign Het
Tmem174 T C 13: 98,773,489 (GRCm39) T114A probably benign Het
Tnc A G 4: 63,926,053 (GRCm39) I909T probably benign Het
Trcg1 A G 9: 57,148,613 (GRCm39) I62V possibly damaging Het
Tulp1 A T 17: 28,575,005 (GRCm39) *487K probably null Het
Unc79 T A 12: 103,097,905 (GRCm39) V1826E possibly damaging Het
Vmn2r13 A T 5: 109,321,982 (GRCm39) N238K probably damaging Het
Vmn2r22 T A 6: 123,614,697 (GRCm39) N298Y probably damaging Het
Vmn2r23 T A 6: 123,689,861 (GRCm39) F246I probably damaging Het
Vps9d1 A C 8: 123,975,378 (GRCm39) V194G probably damaging Het
Zfp260 A T 7: 29,804,235 (GRCm39) H45L possibly damaging Het
Zfp846 A T 9: 20,505,016 (GRCm39) H292L possibly damaging Het
Other mutations in Hus1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Hus1b APN 13 31,131,527 (GRCm39) missense probably benign
IGL02058:Hus1b APN 13 31,130,900 (GRCm39) missense probably benign 0.10
R1104:Hus1b UTSW 13 31,131,679 (GRCm39) intron probably benign
R1476:Hus1b UTSW 13 31,130,984 (GRCm39) missense probably benign 0.10
R3154:Hus1b UTSW 13 31,131,236 (GRCm39) missense probably benign
R4551:Hus1b UTSW 13 31,131,059 (GRCm39) missense probably damaging 1.00
R4583:Hus1b UTSW 13 31,131,501 (GRCm39) missense probably damaging 1.00
R5481:Hus1b UTSW 13 31,130,942 (GRCm39) missense probably benign 0.15
R6519:Hus1b UTSW 13 31,130,930 (GRCm39) missense probably benign 0.01
R7057:Hus1b UTSW 13 31,131,533 (GRCm39) missense possibly damaging 0.62
R7569:Hus1b UTSW 13 31,130,847 (GRCm39) missense probably damaging 1.00
R8175:Hus1b UTSW 13 31,131,215 (GRCm39) missense probably benign 0.25
R9210:Hus1b UTSW 13 31,130,858 (GRCm39) missense possibly damaging 0.72
R9212:Hus1b UTSW 13 31,130,858 (GRCm39) missense possibly damaging 0.72
R9430:Hus1b UTSW 13 31,131,587 (GRCm39) missense probably damaging 0.99
Z1177:Hus1b UTSW 13 31,130,975 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGAACGGCATTTGGAGGATTTC -3'
(R):5'- AGCTGATGTCTGAGCATCTGG -3'

Sequencing Primer
(F):5'- TTCCACCAGCACATGACT -3'
(R):5'- GAATGCCGGCAATGCTTCATC -3'
Posted On 2018-05-24