Incidental Mutation 'R6416:Hus1b'
ID 517955
Institutional Source Beutler Lab
Gene Symbol Hus1b
Ensembl Gene ENSMUSG00000076430
Gene Name HUS1 checkpoint clamp component B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock # R6416 (G1)
Quality Score 183.009
Status Validated
Chromosome 13
Chromosomal Location 30946573-30947759 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 30947205 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 157 (L157Q)
Ref Sequence ENSEMBL: ENSMUSP00000100007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021785] [ENSMUST00000102943] [ENSMUST00000102946]
AlphaFold Q8K572
Predicted Effect probably benign
Transcript: ENSMUST00000021785
SMART Domains Protein: ENSMUSP00000021785
Gene: ENSMUSG00000021357

DomainStartEndE-ValueType
Pfam:TIG 8 92 3.2e-10 PFAM
Pfam:Sec5 198 377 3.6e-59 PFAM
low complexity region 572 585 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102943
AA Change: L157Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100007
Gene: ENSMUSG00000076430
AA Change: L157Q

DomainStartEndE-ValueType
Pfam:Hus1 1 276 1.5e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102946
SMART Domains Protein: ENSMUSP00000100010
Gene: ENSMUSG00000021357

DomainStartEndE-ValueType
Pfam:TIG 8 92 2.5e-10 PFAM
Pfam:Sec5 198 377 7.5e-59 PFAM
low complexity region 572 585 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223216
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.4%
  • 20x: 94.6%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is most closely related to HUS1, a component of a cell cycle checkpoint protein complex involved in cell cycle arrest in response to DNA damage. This protein can interact with the check point protein RAD1 but not with RAD9. Overexpression of this protein has been shown to induce cell death, which suggests a related but distinct role of this protein, as compared to the HUS1. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik C A 16: 88,707,891 R6L unknown Het
Anxa11 A G 14: 25,874,270 Q235R possibly damaging Het
Ap2b1 T A 11: 83,308,239 M1K probably null Het
Atl2 G A 17: 79,850,223 T563I probably benign Het
Azin1 A T 15: 38,492,343 S307R possibly damaging Het
Ccdc153 A G 9: 44,245,780 T118A probably benign Het
Chac1 G A 2: 119,353,534 V206I probably damaging Het
Chrm3 A G 13: 9,877,662 V446A probably benign Het
Cped1 T C 6: 22,123,649 F467S probably damaging Het
Csmd3 G A 15: 48,673,560 P82L probably damaging Het
Ddx60 T A 8: 61,977,950 S840T probably benign Het
Ddx60 C T 8: 61,998,681 H1202Y probably benign Het
Dnah8 T A 17: 30,765,635 N3102K probably benign Het
Dst A T 1: 34,116,128 K85M probably damaging Het
Ehbp1l1 T C 19: 5,718,757 I839M probably benign Het
Fam184b T A 5: 45,537,653 M750L probably benign Het
Frem2 T C 3: 53,572,378 T1965A probably benign Het
Ftl1 A T 7: 45,459,210 D41E probably benign Het
Garem2 G A 5: 30,116,737 W698* probably null Het
Glt8d2 T C 10: 82,652,906 Y283C probably damaging Het
Hars T C 18: 36,773,590 E109G possibly damaging Het
Hspb9 T C 11: 100,714,210 S121P probably damaging Het
Hykk A G 9: 54,946,359 M322V probably benign Het
Igkv4-61 C A 6: 69,417,154 A31S possibly damaging Het
Il17f T A 1: 20,777,907 M116L probably benign Het
Kif22 T C 7: 127,028,932 K9E possibly damaging Het
Krt90 T C 15: 101,559,244 E233G probably benign Het
Lipg T C 18: 74,957,236 M81V probably benign Het
Mocos C T 18: 24,701,456 S850L probably damaging Het
Mug2 T A 6: 122,082,754 S1364T probably damaging Het
Neb A T 2: 52,185,328 N208K probably benign Het
Oca2 G T 7: 56,328,767 R561L probably benign Het
Olfm5 A G 7: 104,154,053 L401P probably damaging Het
Olfr109 T A 17: 37,467,080 Y291* probably null Het
Olfr1238 C A 2: 89,406,522 A186S possibly damaging Het
Olfr331 T C 11: 58,502,340 D72G probably damaging Het
Olfr828 G A 9: 18,815,892 T134M probably benign Het
Olfr952 T A 9: 39,426,891 Y60F probably damaging Het
Oxgr1 T C 14: 120,022,448 N116D probably damaging Het
Pcdha11 G T 18: 37,012,169 probably null Het
Pi4ka T C 16: 17,358,322 I418V probably benign Het
Pih1d2 T C 9: 50,618,609 V62A probably benign Het
Pkib T A 10: 57,728,138 V46E probably damaging Het
Pum1 A G 4: 130,728,287 probably null Het
Rbak G T 5: 143,176,552 Q19K possibly damaging Het
Sema3c A G 5: 17,576,961 T32A probably damaging Het
Shprh T C 10: 11,167,873 W835R probably damaging Het
Sis T G 3: 72,911,854 K1456N probably damaging Het
Slc4a4 A T 5: 89,179,729 N675I probably benign Het
Slc8a3 C A 12: 81,315,627 M139I probably damaging Het
Sorcs3 T C 19: 48,802,759 F1182S probably damaging Het
St8sia2 A T 7: 73,971,921 I96N probably damaging Het
Stx19 T C 16: 62,822,057 S79P probably damaging Het
Tecta C T 9: 42,375,267 V698M probably damaging Het
Timm22 T C 11: 76,411,139 S150P probably damaging Het
Tjp1 C T 7: 65,313,205 D995N possibly damaging Het
Tmem135 T A 7: 89,147,794 T365S probably benign Het
Tmem174 T C 13: 98,636,981 T114A probably benign Het
Tnc A G 4: 64,007,816 I909T probably benign Het
Trcg1 A G 9: 57,241,330 I62V possibly damaging Het
Tulp1 A T 17: 28,356,031 *487K probably null Het
Unc79 T A 12: 103,131,646 V1826E possibly damaging Het
Vmn2r13 A T 5: 109,174,116 N238K probably damaging Het
Vmn2r22 T A 6: 123,637,738 N298Y probably damaging Het
Vmn2r23 T A 6: 123,712,902 F246I probably damaging Het
Vps9d1 A C 8: 123,248,639 V194G probably damaging Het
Zfp260 A T 7: 30,104,810 H45L possibly damaging Het
Zfp846 A T 9: 20,593,720 H292L possibly damaging Het
Other mutations in Hus1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Hus1b APN 13 30947544 missense probably benign
IGL02058:Hus1b APN 13 30946917 missense probably benign 0.10
R1104:Hus1b UTSW 13 30947696 intron probably benign
R1476:Hus1b UTSW 13 30947001 missense probably benign 0.10
R3154:Hus1b UTSW 13 30947253 missense probably benign
R4551:Hus1b UTSW 13 30947076 missense probably damaging 1.00
R4583:Hus1b UTSW 13 30947518 missense probably damaging 1.00
R5481:Hus1b UTSW 13 30946959 missense probably benign 0.15
R6519:Hus1b UTSW 13 30946947 missense probably benign 0.01
R7057:Hus1b UTSW 13 30947550 missense possibly damaging 0.62
R7569:Hus1b UTSW 13 30946864 missense probably damaging 1.00
R8175:Hus1b UTSW 13 30947232 missense probably benign 0.25
R9210:Hus1b UTSW 13 30946875 missense possibly damaging 0.72
R9212:Hus1b UTSW 13 30946875 missense possibly damaging 0.72
R9430:Hus1b UTSW 13 30947604 missense probably damaging 0.99
Z1177:Hus1b UTSW 13 30946992 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGAACGGCATTTGGAGGATTTC -3'
(R):5'- AGCTGATGTCTGAGCATCTGG -3'

Sequencing Primer
(F):5'- TTCCACCAGCACATGACT -3'
(R):5'- GAATGCCGGCAATGCTTCATC -3'
Posted On 2018-05-24